Incidental Mutation 'R6535:Chrm1'
ID520375
Institutional Source Beutler Lab
Gene Symbol Chrm1
Ensembl Gene ENSMUSG00000032773
Gene Namecholinergic receptor, muscarinic 1, CNS
Synonymsmuscarinic acetylcholine receptor 1, M1R, M1, AW495047, Chrm-1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.111) question?
Stock #R6535 (G1)
Quality Score225.009
Status Not validated
Chromosome19
Chromosomal Location8663789-8683587 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 8679073 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Asparagine at position 381 (Y381N)
Ref Sequence ENSEMBL: ENSMUSP00000126103 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035444] [ENSMUST00000163785] [ENSMUST00000177197]
Predicted Effect possibly damaging
Transcript: ENSMUST00000035444
AA Change: Y381N

PolyPhen 2 Score 0.931 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000042632
Gene: ENSMUSG00000032773
AA Change: Y381N

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 36 227 1.7e-7 PFAM
Pfam:7tm_1 42 418 1.9e-97 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000157205
Predicted Effect possibly damaging
Transcript: ENSMUST00000163785
AA Change: Y381N

PolyPhen 2 Score 0.931 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000126103
Gene: ENSMUSG00000032773
AA Change: Y381N

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 36 227 1.7e-7 PFAM
Pfam:7tm_1 42 418 2.9e-83 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000177197
SMART Domains Protein: ENSMUSP00000135356
Gene: ENSMUSG00000032773

DomainStartEndE-ValueType
Pfam:7tm_1 42 74 1.6e-9 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The muscarinic cholinergic receptors belong to a larger family of G protein-coupled receptors. The functional diversity of these receptors is defined by the binding of acetylcholine and includes cellular responses such as adenylate cyclase inhibition, phosphoinositide degeneration, and potassium channel mediation. Muscarinic receptors influence many effects of acetylcholine in the central and peripheral nervous system. The muscarinic cholinergic receptor 1 is involved in mediation of vagally-induced bronchoconstriction and in the acid secretion of the gastrointestinal tract. The gene encoding this receptor is localized to 11q13. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations exhibit resistance to pilocarpine-induced seizures, selective memory deficits, elevated dopaminergic transmission in the striatum, and increased spontaneous and amphetamine-induced locomotion. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 27 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrf5 G A 17: 43,440,029 S495N probably benign Het
Ank3 G T 10: 69,877,854 A448S probably damaging Het
Apobec3 A G 15: 79,897,749 *47W probably null Het
B4gat1 T C 19: 5,039,530 V185A possibly damaging Het
Cers1 T A 8: 70,330,154 V58D probably damaging Het
Cpne6 A T 14: 55,513,665 E177V probably benign Het
Cpt1a T A 19: 3,365,788 probably null Het
Ctsq A T 13: 61,035,326 I334N probably damaging Het
D730001G18Rik T C 15: 74,772,225 S81G probably damaging Het
Dennd6b A G 15: 89,186,367 L400P probably damaging Het
Fam135b A G 15: 71,622,075 S2P probably damaging Het
Gm20767 T C 13: 120,154,654 S10P probably damaging Het
Hip1 T C 5: 135,428,497 probably null Het
Lama2 A C 10: 27,104,131 L1896R probably damaging Het
Macf1 A T 4: 123,471,935 V3011D possibly damaging Het
Macrod1 A G 19: 7,057,147 D86G probably damaging Het
Mettl8 G T 2: 70,973,389 H185N possibly damaging Het
Mipol1 A C 12: 57,306,100 Q75P possibly damaging Het
Pi4ka C T 16: 17,301,036 V125M probably damaging Het
Pole A C 5: 110,324,807 Y1618S probably damaging Het
Prrc2a A G 17: 35,162,265 V21A unknown Het
Rhbdl1 A T 17: 25,835,825 Y111* probably null Het
Sbk3 A C 7: 4,969,841 M110R possibly damaging Het
Scn8a G A 15: 100,959,707 probably benign Het
Tshz3 T C 7: 36,768,789 S68P probably damaging Het
Vmn1r88 C T 7: 13,178,185 T156I probably benign Het
Wrn T C 8: 33,336,103 H177R probably damaging Het
Other mutations in Chrm1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00466:Chrm1 APN 19 8678074 missense probably benign 0.01
IGL01633:Chrm1 APN 19 8678495 missense probably benign 0.29
IGL01824:Chrm1 APN 19 8679130 missense probably damaging 0.98
IGL02539:Chrm1 APN 19 8678311 missense probably damaging 1.00
IGL03342:Chrm1 APN 19 8679308 missense probably benign 0.33
R1660:Chrm1 UTSW 19 8679218 missense possibly damaging 0.53
R1942:Chrm1 UTSW 19 8678273 missense probably damaging 0.99
R2208:Chrm1 UTSW 19 8678099 missense probably damaging 1.00
R6466:Chrm1 UTSW 19 8678178 nonsense probably null
R6720:Chrm1 UTSW 19 8678548 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGGTAGATCCTGAGGCACAG -3'
(R):5'- AAGATGCAGCCCATTTTCCG -3'

Sequencing Primer
(F):5'- TGAGGCACAGGCACCCAC -3'
(R):5'- AGGGGGCCATTAGCATTGGC -3'
Posted On2018-06-06