Incidental Mutation 'R6473:Thbs2'
ID520376
Institutional Source Beutler Lab
Gene Symbol Thbs2
Ensembl Gene ENSMUSG00000023885
Gene Namethrombospondin 2
SynonymsThbs-2, Thrombospondin-2, TSP2
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.208) question?
Stock #R6473 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location14665500-14694235 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 14685796 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 281 (S281P)
Ref Sequence ENSEMBL: ENSMUSP00000128308 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000170872]
Predicted Effect probably benign
Transcript: ENSMUST00000170872
AA Change: S281P

PolyPhen 2 Score 0.232 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000128308
Gene: ENSMUSG00000023885
AA Change: S281P

DomainStartEndE-ValueType
low complexity region 2 10 N/A INTRINSIC
TSPN 21 215 3.8e-60 SMART
VWC 320 374 3.55e-19 SMART
TSP1 384 431 3.36e-11 SMART
TSP1 440 492 1.35e-15 SMART
TSP1 497 549 8.6e-18 SMART
EGF 552 589 6.3e-3 SMART
EGF 593 647 1.56e1 SMART
EGF 651 692 2.19e-2 SMART
Pfam:TSP_3 729 764 2.5e-12 PFAM
Pfam:TSP_3 763 787 7.4e-7 PFAM
Pfam:TSP_3 788 823 9.4e-12 PFAM
Pfam:TSP_3 823 846 4.1e-7 PFAM
Pfam:TSP_3 847 884 1.7e-12 PFAM
Pfam:TSP_3 885 920 1.3e-11 PFAM
Pfam:TSP_3 921 956 3.1e-11 PFAM
Pfam:TSP_C 974 1171 1e-98 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.4%
  • 10x: 96.9%
  • 20x: 89.9%
Validation Efficiency 95% (36/38)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the thrombospondin family. It is a disulfide-linked homotrimeric glycoprotein that mediates cell-to-cell and cell-to-matrix interactions. This protein has been shown to function as a potent inhibitor of tumor growth and angiogenesis. Studies of the mouse counterpart suggest that this protein may modulate the cell surface properties of mesenchymal cells and be involved in cell adhesion and migration. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele display premature death, abnormal tails, marked structural and functional abnormalities in a variety of connective tissues including skin, tendon, bone, and blood vessels, accelerated wound healing, and enhanced susceptibility to experimental skin tumors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts1 T C 16: 85,799,643 D106G probably damaging Het
Adat3 A G 10: 80,606,967 D213G probably damaging Het
Akt1 T C 12: 112,662,260 D32G probably damaging Het
Ampd1 C T 3: 103,095,646 R61* probably null Het
Ash2l T A 8: 25,834,980 T184S probably damaging Het
B3galnt1 T C 3: 69,575,340 N196S possibly damaging Het
Chmp2b C T 16: 65,546,872 G96S probably damaging Het
Cyp2d26 T C 15: 82,791,767 N248S probably benign Het
Cyp46a1 G T 12: 108,355,475 R320L possibly damaging Het
Dact1 A G 12: 71,317,698 T418A probably benign Het
Ddx3y T C Y: 1,265,971 Y342C possibly damaging Homo
Dnm3 T A 1: 162,477,705 Q40L probably damaging Het
Eif2s1 T C 12: 78,881,225 I225T probably damaging Het
Enpp5 G A 17: 44,085,264 G356S probably damaging Het
Eps8 A T 6: 137,479,098 I795N probably damaging Het
Fan1 T A 7: 64,372,486 N340Y probably damaging Het
Fbxw7 T C 3: 84,952,380 probably benign Het
Gba C T 3: 89,204,081 P51L probably benign Het
Idh3b AG AGCACCACAACTG 2: 130,279,673 probably null Het
Kalrn A G 16: 34,205,302 I551T probably damaging Het
Madd T C 2: 91,167,059 T755A probably benign Het
Mrps31 A G 8: 22,414,865 D90G probably benign Het
Olfr115 T A 17: 37,609,996 T252S possibly damaging Het
Olfr191 A T 16: 59,086,043 L147M probably benign Het
P2ry12 T A 3: 59,217,511 I248F probably benign Het
Ptgfrn T C 3: 101,045,639 R760G probably damaging Het
Rsf1 CG CGACGGCGGGG 7: 97,579,908 probably benign Homo
Slpi T C 2: 164,354,926 Y116C probably damaging Het
St3gal1 A G 15: 67,111,346 V187A possibly damaging Het
Terb1 T A 8: 104,473,037 E425V probably damaging Het
Tnik A G 3: 28,263,643 M1V probably null Het
Usp16 G A 16: 87,483,135 S741N probably benign Het
Usp48 T C 4: 137,609,108 probably null Het
Vipr1 T C 9: 121,668,555 S380P probably damaging Het
Vmn1r21 A T 6: 57,843,598 I287K probably damaging Het
Zfp157 T C 5: 138,455,926 C129R probably damaging Het
Other mutations in Thbs2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00155:Thbs2 APN 17 14668835 missense probably damaging 1.00
IGL00764:Thbs2 APN 17 14690252 missense probably damaging 0.98
IGL01370:Thbs2 APN 17 14690065 missense possibly damaging 0.82
IGL01604:Thbs2 APN 17 14678769 missense probably benign 0.31
IGL01936:Thbs2 APN 17 14687814 missense probably benign 0.00
IGL02061:Thbs2 APN 17 14679914 missense probably benign 0.35
IGL02255:Thbs2 APN 17 14689785 missense probably benign 0.00
IGL02342:Thbs2 APN 17 14676316 missense probably damaging 1.00
IGL02402:Thbs2 APN 17 14671454 missense probably benign 0.01
IGL02499:Thbs2 APN 17 14684066 splice site probably benign
IGL02572:Thbs2 APN 17 14677013 missense possibly damaging 0.72
IGL02701:Thbs2 APN 17 14683361 missense probably benign 0.05
IGL02871:Thbs2 APN 17 14685786 missense probably benign
IGL03058:Thbs2 APN 17 14689969 missense possibly damaging 0.91
IGL03185:Thbs2 APN 17 14681410 nonsense probably null
IGL03232:Thbs2 APN 17 14691413 start codon destroyed probably null
IGL03289:Thbs2 APN 17 14690122 missense probably benign 0.00
IGL03407:Thbs2 APN 17 14673273 missense probably benign 0.00
H8562:Thbs2 UTSW 17 14671453 missense probably benign 0.00
IGL02802:Thbs2 UTSW 17 14684127 missense probably benign 0.01
PIT4354001:Thbs2 UTSW 17 14689968 missense probably damaging 0.99
R0088:Thbs2 UTSW 17 14681701 missense possibly damaging 0.96
R0167:Thbs2 UTSW 17 14667525 splice site probably benign
R0415:Thbs2 UTSW 17 14679973 missense probably benign
R0658:Thbs2 UTSW 17 14680325 missense probably benign 0.00
R0735:Thbs2 UTSW 17 14679815 missense probably benign 0.00
R1582:Thbs2 UTSW 17 14671288 missense probably damaging 1.00
R1585:Thbs2 UTSW 17 14689768 missense probably benign 0.00
R1608:Thbs2 UTSW 17 14685781 missense probably benign
R1721:Thbs2 UTSW 17 14678810 missense probably benign 0.00
R1724:Thbs2 UTSW 17 14685900 missense possibly damaging 0.80
R1791:Thbs2 UTSW 17 14685813 missense probably benign
R1816:Thbs2 UTSW 17 14670713 missense probably benign 0.01
R1816:Thbs2 UTSW 17 14670714 missense probably benign 0.00
R1911:Thbs2 UTSW 17 14689842 missense probably benign 0.38
R2137:Thbs2 UTSW 17 14673306 missense probably damaging 1.00
R2152:Thbs2 UTSW 17 14673209 missense probably damaging 1.00
R2244:Thbs2 UTSW 17 14671413 missense probably damaging 1.00
R2325:Thbs2 UTSW 17 14690289 splice site probably null
R2509:Thbs2 UTSW 17 14685843 missense probably benign 0.11
R3838:Thbs2 UTSW 17 14687851 missense probably benign
R4173:Thbs2 UTSW 17 14681631 intron probably null
R4427:Thbs2 UTSW 17 14680335 missense probably benign
R4495:Thbs2 UTSW 17 14671413 missense probably damaging 1.00
R4789:Thbs2 UTSW 17 14671488 missense probably damaging 1.00
R4928:Thbs2 UTSW 17 14678900 missense probably damaging 1.00
R5058:Thbs2 UTSW 17 14676329 missense probably damaging 1.00
R5112:Thbs2 UTSW 17 14670590 splice site probably null
R5619:Thbs2 UTSW 17 14681244 missense probably damaging 1.00
R5649:Thbs2 UTSW 17 14689953 missense probably damaging 1.00
R5664:Thbs2 UTSW 17 14689837 missense probably damaging 1.00
R5801:Thbs2 UTSW 17 14687863 missense probably damaging 1.00
R5816:Thbs2 UTSW 17 14684071 critical splice donor site probably null
R5840:Thbs2 UTSW 17 14681430 splice site probably null
R6149:Thbs2 UTSW 17 14679680 critical splice donor site probably null
R6166:Thbs2 UTSW 17 14680388 missense probably damaging 1.00
R6412:Thbs2 UTSW 17 14677077 missense probably damaging 1.00
R6640:Thbs2 UTSW 17 14673368 missense possibly damaging 0.94
R6695:Thbs2 UTSW 17 14674164 missense possibly damaging 0.54
R6711:Thbs2 UTSW 17 14690265 missense probably benign 0.00
R6947:Thbs2 UTSW 17 14689767 missense possibly damaging 0.79
R6962:Thbs2 UTSW 17 14681820 missense probably benign 0.00
R7183:Thbs2 UTSW 17 14690116 missense possibly damaging 0.90
R7203:Thbs2 UTSW 17 14671458 missense probably damaging 1.00
S24628:Thbs2 UTSW 17 14679973 missense probably benign
X0025:Thbs2 UTSW 17 14681800 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- TGAAGTATTGGTCCCCAGAGGC -3'
(R):5'- CAGCTTACAGTTGCAAGCCTG -3'

Sequencing Primer
(F):5'- TCCCCAGAGGCCTGACTG -3'
(R):5'- AGAGACTGTGCTCCGCTATAATTC -3'
Posted On2018-06-06