Incidental Mutation 'R6495:Rapsn'
ID520390
Institutional Source Beutler Lab
Gene Symbol Rapsn
Ensembl Gene ENSMUSG00000002104
Gene Namereceptor-associated protein of the synapse
SynonymsNraps, rapsyn, 43kDa acetylcholine receptor-associated protein, Raps
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6495 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location91035620-91045729 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 91036628 bp
ZygosityHeterozygous
Amino Acid Change Serine to Cysteine at position 92 (S92C)
Ref Sequence ENSEMBL: ENSMUSP00000107073 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050323] [ENSMUST00000111445] [ENSMUST00000111446]
Predicted Effect probably damaging
Transcript: ENSMUST00000050323
AA Change: S92C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000054150
Gene: ENSMUSG00000002104
AA Change: S92C

DomainStartEndE-ValueType
TPR 6 39 5.62e1 SMART
Blast:TPR 43 74 2e-10 BLAST
TPR 83 116 2.56e1 SMART
TPR 123 156 1.11e-2 SMART
TPR 163 196 8.29e0 SMART
TPR 206 239 1.24e0 SMART
Blast:TPR 246 279 1e-14 BLAST
TPR 286 319 2.07e1 SMART
RING 363 402 2.67e-5 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000111445
AA Change: S92C

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000107072
Gene: ENSMUSG00000002104
AA Change: S92C

DomainStartEndE-ValueType
TPR 6 39 5.62e1 SMART
Blast:TPR 43 74 1e-10 BLAST
TPR 83 116 2.56e1 SMART
TPR 123 156 1.11e-2 SMART
TPR 163 196 8.29e0 SMART
TPR 206 239 1.24e0 SMART
RING 304 343 2.67e-5 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000111446
AA Change: S92C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000107073
Gene: ENSMUSG00000002104
AA Change: S92C

DomainStartEndE-ValueType
TPR 6 39 5.62e1 SMART
Blast:TPR 43 74 1e-10 BLAST
TPR 83 116 2.56e1 SMART
TPR 123 156 1.11e-2 SMART
Blast:TPR 193 226 9e-15 BLAST
TPR 233 266 2.07e1 SMART
RING 310 349 2.67e-5 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.8%
Validation Efficiency 100% (50/50)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a family of proteins that are receptor associated proteins of the synapse. The encoded protein contains a conserved cAMP-dependent protein kinase phosphorylation site, and plays a critical role in clustering and anchoring nicotinic acetylcholine receptors at synaptic sites by linking the receptors to the underlying postsynaptic cytoskeleton, possibly by direct association with actin or spectrin. Mutations in this gene may play a role in postsynaptic congenital myasthenic syndromes. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Apr 2011]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit absence of acetylcholine receptor clusters at end plate band of neuromuscular synapses, muscle weakness, and respiratory distress leading to lethality within hours of birth. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ahnak2 T A 12: 112,773,714 E502V probably damaging Het
Apbb1ip T A 2: 22,853,120 Y321* probably null Het
Apob A G 12: 7,990,394 K577R probably null Het
Arfgef3 A G 10: 18,611,202 probably null Het
Asap3 T A 4: 136,228,479 probably null Het
Atp13a5 C T 16: 29,321,622 probably null Het
Bcan C A 3: 87,996,597 A194S possibly damaging Het
Cacybp T C 1: 160,208,523 T32A probably benign Het
Cd82 A G 2: 93,430,012 V90A probably benign Het
Chd5 C T 4: 152,367,372 R714C probably damaging Het
Cpb2 T C 14: 75,275,079 Y311H probably damaging Het
Cyp39a1 T C 17: 43,691,694 Y267H probably benign Het
Dnajc6 C T 4: 101,635,065 Q766* probably null Het
Dusp3 T C 11: 101,981,827 I48V probably benign Het
Eif3c A T 7: 126,547,500 F809I probably damaging Het
Exosc10 C T 4: 148,562,872 P213S probably benign Het
Galns C T 8: 122,600,610 G141D probably damaging Het
Gm3233 A T 10: 77,759,052 probably benign Het
Hadha A T 5: 30,120,050 L714H probably benign Het
Map3k20 T C 2: 72,368,419 M123T probably damaging Het
Nt5dc1 A G 10: 34,324,369 L217P probably damaging Het
Nubp2 A T 17: 24,885,603 D54E probably damaging Het
Olfr1471 T A 19: 13,445,625 D204E probably benign Het
Onecut1 C T 9: 74,863,215 R307C probably damaging Het
Pcdhb17 A G 18: 37,485,667 Y170C probably damaging Het
Pkd2 T A 5: 104,489,293 C591S probably damaging Het
Pramef20 T C 4: 144,376,839 N239S probably benign Het
Pwp2 A T 10: 78,177,127 V549E probably damaging Het
Rbm19 A G 5: 120,119,680 S90G probably damaging Het
Rfc1 G A 5: 65,273,815 probably null Het
Rims2 T A 15: 39,517,812 F1046L probably benign Het
S100a16 C T 3: 90,542,428 R73C probably benign Het
Shroom3 T C 5: 92,942,069 Y893H possibly damaging Het
Stt3b T A 9: 115,267,320 Y253F possibly damaging Het
Taar8b A G 10: 24,091,262 *345Q probably null Het
Tas2r119 G A 15: 32,177,530 V81I probably benign Het
Tas2r129 A G 6: 132,951,165 I22V probably benign Het
Tbc1d19 T G 5: 53,889,213 probably null Het
Tnip3 A T 6: 65,605,862 I218F probably benign Het
Tnks A T 8: 34,839,966 probably null Het
Ttc29 T C 8: 78,282,334 Y278H possibly damaging Het
Uba7 T A 9: 107,977,014 C214* probably null Het
Vmn2r115 A T 17: 23,359,598 I682F probably benign Het
Vmn2r75 A T 7: 86,164,079 M505K probably benign Het
Wdr19 A T 5: 65,258,123 T1313S probably benign Het
Zbtb22 A G 17: 33,917,250 D123G probably damaging Het
Zcchc6 T C 13: 59,799,939 E454G possibly damaging Het
Zdhhc7 A G 8: 120,086,656 I138T probably benign Het
Zfp706 T C 15: 37,003,801 K7R unknown Het
Zkscan3 G A 13: 21,387,905 P519L probably damaging Het
Other mutations in Rapsn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00336:Rapsn APN 2 91035860 missense probably damaging 1.00
IGL01386:Rapsn APN 2 91036799 missense probably damaging 1.00
IGL01517:Rapsn APN 2 91036618 missense probably damaging 1.00
IGL01707:Rapsn APN 2 91043240 missense probably benign 0.03
IGL02322:Rapsn APN 2 91041906 missense possibly damaging 0.80
IGL02800:Rapsn APN 2 91043239 missense probably benign
rasputin UTSW 2 91035924 missense probably damaging 1.00
R0744:Rapsn UTSW 2 91036808 missense probably damaging 0.99
R0833:Rapsn UTSW 2 91036808 missense probably damaging 0.99
R0836:Rapsn UTSW 2 91036808 missense probably damaging 0.99
R1224:Rapsn UTSW 2 91043198 missense probably damaging 1.00
R1294:Rapsn UTSW 2 91036775 nonsense probably null
R1619:Rapsn UTSW 2 91043159 missense possibly damaging 0.84
R2891:Rapsn UTSW 2 91036824 missense probably damaging 0.98
R2892:Rapsn UTSW 2 91036824 missense probably damaging 0.98
R2893:Rapsn UTSW 2 91036824 missense probably damaging 0.98
R4135:Rapsn UTSW 2 91036817 missense probably damaging 0.99
R4515:Rapsn UTSW 2 91043212 missense possibly damaging 0.91
R5689:Rapsn UTSW 2 91035924 missense probably damaging 1.00
R5860:Rapsn UTSW 2 91045514 missense probably damaging 1.00
R5953:Rapsn UTSW 2 91041963 missense probably benign 0.04
X0064:Rapsn UTSW 2 91043003 missense probably benign 0.14
Predicted Primers PCR Primer
(F):5'- TCTCTGCTATGACTGGAGCC -3'
(R):5'- CTTCTCAAAGCTCTCCAGGG -3'

Sequencing Primer
(F):5'- AAACTCTTGAGTCTGAGCTTCAGG -3'
(R):5'- AAAGCTCTCCAGGGCCTTCTG -3'
Posted On2018-06-06