Incidental Mutation 'R6495:Pramef20'
ID520402
Institutional Source Beutler Lab
Gene Symbol Pramef20
Ensembl Gene ENSMUSG00000073721
Gene NamePRAME family member 20
SynonymsGm13125, EG627009
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6495 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location144372760-144377933 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 144376839 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 239 (N239S)
Ref Sequence ENSEMBL: ENSMUSP00000112488 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000121109]
Predicted Effect probably benign
Transcript: ENSMUST00000121109
AA Change: N239S

PolyPhen 2 Score 0.431 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000112488
Gene: ENSMUSG00000073721
AA Change: N239S

DomainStartEndE-ValueType
SCOP:d1a4ya_ 222 409 1e-11 SMART
Meta Mutation Damage Score 0.1312 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.8%
Validation Efficiency 100% (50/50)
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ahnak2 T A 12: 112,773,714 E502V probably damaging Het
Apbb1ip T A 2: 22,853,120 Y321* probably null Het
Apob A G 12: 7,990,394 K577R probably null Het
Arfgef3 A G 10: 18,611,202 probably null Het
Asap3 T A 4: 136,228,479 probably null Het
Atp13a5 C T 16: 29,321,622 probably null Het
Bcan C A 3: 87,996,597 A194S possibly damaging Het
Cacybp T C 1: 160,208,523 T32A probably benign Het
Cd82 A G 2: 93,430,012 V90A probably benign Het
Chd5 C T 4: 152,367,372 R714C probably damaging Het
Cpb2 T C 14: 75,275,079 Y311H probably damaging Het
Cyp39a1 T C 17: 43,691,694 Y267H probably benign Het
Dnajc6 C T 4: 101,635,065 Q766* probably null Het
Dusp3 T C 11: 101,981,827 I48V probably benign Het
Eif3c A T 7: 126,547,500 F809I probably damaging Het
Exosc10 C T 4: 148,562,872 P213S probably benign Het
Galns C T 8: 122,600,610 G141D probably damaging Het
Gm3233 A T 10: 77,759,052 probably benign Het
Hadha A T 5: 30,120,050 L714H probably benign Het
Map3k20 T C 2: 72,368,419 M123T probably damaging Het
Nt5dc1 A G 10: 34,324,369 L217P probably damaging Het
Nubp2 A T 17: 24,885,603 D54E probably damaging Het
Olfr1471 T A 19: 13,445,625 D204E probably benign Het
Onecut1 C T 9: 74,863,215 R307C probably damaging Het
Pcdhb17 A G 18: 37,485,667 Y170C probably damaging Het
Pkd2 T A 5: 104,489,293 C591S probably damaging Het
Pwp2 A T 10: 78,177,127 V549E probably damaging Het
Rapsn A T 2: 91,036,628 S92C probably damaging Het
Rbm19 A G 5: 120,119,680 S90G probably damaging Het
Rfc1 G A 5: 65,273,815 probably null Het
Rims2 T A 15: 39,517,812 F1046L probably benign Het
S100a16 C T 3: 90,542,428 R73C probably benign Het
Shroom3 T C 5: 92,942,069 Y893H possibly damaging Het
Stt3b T A 9: 115,267,320 Y253F possibly damaging Het
Taar8b A G 10: 24,091,262 *345Q probably null Het
Tas2r119 G A 15: 32,177,530 V81I probably benign Het
Tas2r129 A G 6: 132,951,165 I22V probably benign Het
Tbc1d19 T G 5: 53,889,213 probably null Het
Tnip3 A T 6: 65,605,862 I218F probably benign Het
Tnks A T 8: 34,839,966 probably null Het
Ttc29 T C 8: 78,282,334 Y278H possibly damaging Het
Uba7 T A 9: 107,977,014 C214* probably null Het
Vmn2r115 A T 17: 23,359,598 I682F probably benign Het
Vmn2r75 A T 7: 86,164,079 M505K probably benign Het
Wdr19 A T 5: 65,258,123 T1313S probably benign Het
Zbtb22 A G 17: 33,917,250 D123G probably damaging Het
Zcchc6 T C 13: 59,799,939 E454G possibly damaging Het
Zdhhc7 A G 8: 120,086,656 I138T probably benign Het
Zfp706 T C 15: 37,003,801 K7R unknown Het
Zkscan3 G A 13: 21,387,905 P519L probably damaging Het
Other mutations in Pramef20
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01403:Pramef20 APN 4 144377133 missense probably benign 0.01
IGL01516:Pramef20 APN 4 144377767 missense probably damaging 1.00
IGL02655:Pramef20 APN 4 144372846 missense probably benign 0.05
IGL02983:Pramef20 APN 4 144373127 missense probably benign 0.24
R0201:Pramef20 UTSW 4 144377273 splice site probably benign
R1882:Pramef20 UTSW 4 144376915 missense probably benign 0.03
R4440:Pramef20 UTSW 4 144372867 missense probably benign
R4805:Pramef20 UTSW 4 144377020 missense probably benign 0.08
R4823:Pramef20 UTSW 4 144373211 missense possibly damaging 0.81
R4925:Pramef20 UTSW 4 144377932 start codon destroyed probably null 1.00
R5024:Pramef20 UTSW 4 144373308 nonsense probably null
R5472:Pramef20 UTSW 4 144377157 missense probably benign 0.00
R6133:Pramef20 UTSW 4 144377777 missense possibly damaging 0.81
R6585:Pramef20 UTSW 4 144377030 missense possibly damaging 0.87
R6732:Pramef20 UTSW 4 144373173 missense probably benign 0.20
R7048:Pramef20 UTSW 4 144377184 missense probably benign 0.15
R7165:Pramef20 UTSW 4 144372819 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- ACTACAGTGGCAGCAAGGAC -3'
(R):5'- AAGCTTCAGATCTGGTCACCATC -3'

Sequencing Primer
(F):5'- GTAAAGGAATAAGGGTTTGATTTGC -3'
(R):5'- TTCAGATCTGGTCACCATCCCAAC -3'
Posted On2018-06-06