Mutagenetix > Incidental Mutation

Incidental Mutation 'R6495:Chd5'

520406

Institutional Source

Beutler Lab

Gene Symbol

Chd5

Ensembl Gene

ENSMUSG00000005045

Gene Name

chromodomain helicase DNA binding protein 5

Synonyms

B230399N07Rik, 4930532L22Rik

MMRRC Submission

044627-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6495 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

152423108-152474651 bp(+) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 152451829 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Cysteine at position 714 (R714C)

Ref Sequence

ENSEMBL: ENSMUSP00000132600 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000005175] [ENSMUST00000030775] [ENSMUST00000164662]

AlphaFold

A2A8L1

Predicted Effect

probably damaging
Transcript: ENSMUST00000005175
AA Change: R714C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000005175
Gene: ENSMUSG00000005045
AA Change: R714C

Domain	Start	End	E-Value	Type
low complexity region	17	40	N/A	INTRINSIC
low complexity region	46	71	N/A	INTRINSIC
low complexity region	76	92	N/A	INTRINSIC
coiled coil region	96	126	N/A	INTRINSIC
Pfam:CHDNT	149	203	2e-32	PFAM
low complexity region	209	220	N/A	INTRINSIC
low complexity region	256	273	N/A	INTRINSIC
low complexity region	291	304	N/A	INTRINSIC
low complexity region	323	333	N/A	INTRINSIC
PHD	347	390	1.09e-14	SMART
RING	348	389	4.48e-1	SMART
low complexity region	400	416	N/A	INTRINSIC
PHD	420	463	3.29e-14	SMART
RING	421	462	4.15e0	SMART
CHROMO	468	548	2.52e-13	SMART
CHROMO	592	649	1.34e-8	SMART
low complexity region	657	678	N/A	INTRINSIC
DEXDc	698	910	8.34e-33	SMART
low complexity region	1023	1038	N/A	INTRINSIC
HELICc	1056	1140	4.02e-26	SMART
DUF1087	1297	1361	2.78e-33	SMART
DUF1086	1374	1533	5.11e-105	SMART
low complexity region	1552	1567	N/A	INTRINSIC
low complexity region	1685	1701	N/A	INTRINSIC
Pfam:CHDCT2	1729	1901	1.7e-99	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000030775
AA Change: R714C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000030775
Gene: ENSMUSG00000005045
AA Change: R714C

Domain	Start	End	E-Value	Type
low complexity region	17	40	N/A	INTRINSIC
low complexity region	46	71	N/A	INTRINSIC
low complexity region	76	92	N/A	INTRINSIC
coiled coil region	96	126	N/A	INTRINSIC
Pfam:CHDNT	150	203	9e-28	PFAM
low complexity region	209	220	N/A	INTRINSIC
low complexity region	256	273	N/A	INTRINSIC
low complexity region	291	304	N/A	INTRINSIC
low complexity region	323	333	N/A	INTRINSIC
PHD	347	390	1.09e-14	SMART
RING	348	389	4.48e-1	SMART
low complexity region	400	416	N/A	INTRINSIC
PHD	420	463	3.29e-14	SMART
RING	421	462	4.15e0	SMART
CHROMO	468	548	2.52e-13	SMART
CHROMO	592	649	1.34e-8	SMART
low complexity region	657	678	N/A	INTRINSIC
DEXDc	698	910	8.34e-33	SMART
low complexity region	1023	1038	N/A	INTRINSIC
HELICc	1056	1140	4.02e-26	SMART
DUF1087	1297	1361	2.78e-33	SMART
DUF1086	1374	1533	5.11e-105	SMART
low complexity region	1552	1567	N/A	INTRINSIC
low complexity region	1685	1701	N/A	INTRINSIC
Pfam:CHDCT2	1730	1901	2.8e-93	PFAM
low complexity region	1922	1936	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000124423

Predicted Effect

probably damaging
Transcript: ENSMUST00000164662
AA Change: R714C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000132600
Gene: ENSMUSG00000005045
AA Change: R714C

Domain	Start	End	E-Value	Type
low complexity region	17	40	N/A	INTRINSIC
low complexity region	46	71	N/A	INTRINSIC
low complexity region	76	92	N/A	INTRINSIC
coiled coil region	96	126	N/A	INTRINSIC
Pfam:CHDNT	149	203	1.9e-32	PFAM
low complexity region	209	220	N/A	INTRINSIC
low complexity region	256	273	N/A	INTRINSIC
low complexity region	291	304	N/A	INTRINSIC
low complexity region	323	333	N/A	INTRINSIC
PHD	347	390	1.09e-14	SMART
RING	348	389	4.48e-1	SMART
low complexity region	400	416	N/A	INTRINSIC
PHD	420	463	3.29e-14	SMART
RING	421	462	4.15e0	SMART
CHROMO	468	548	2.52e-13	SMART
CHROMO	592	649	1.34e-8	SMART
low complexity region	657	678	N/A	INTRINSIC
DEXDc	698	910	8.34e-33	SMART
low complexity region	1023	1038	N/A	INTRINSIC
HELICc	1056	1140	4.02e-26	SMART
DUF1087	1260	1324	2.78e-33	SMART
DUF1086	1337	1496	5.11e-105	SMART
low complexity region	1515	1530	N/A	INTRINSIC
low complexity region	1648	1664	N/A	INTRINSIC
Pfam:CHDCT2	1692	1864	1.7e-99	PFAM
low complexity region	1885	1899	N/A	INTRINSIC

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 97.9%
20x: 93.8%

Validation Efficiency

100% (50/50)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the chromodomain helicase DNA-binding protein family. Members of this family are characterized by a chromodomain, a helicase ATP-binding domain and an additional functional domain. This gene encodes a neuron-specific protein that may function in chromatin remodeling and gene transcription. This gene is a potential tumor suppressor gene that may play a role in the development of neuroblastoma. [provided by RefSeq, Feb 2012]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit male infertility with abnormal spermiogenesis and chromatin condensation. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 50 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Ahnak2	T	A	12: 112,740,148 (GRCm39)	E502V	probably damaging	Het
Apbb1ip	T	A	2: 22,743,132 (GRCm39)	Y321*	probably null	Het
Apob	A	G	12: 8,040,394 (GRCm39)	K577R	probably null	Het
Arfgef3	A	G	10: 18,486,950 (GRCm39)		probably null	Het
Asap3	T	A	4: 135,955,790 (GRCm39)		probably null	Het
Atp13a5	C	T	16: 29,140,440 (GRCm39)		probably null	Het
Bcan	C	A	3: 87,903,904 (GRCm39)	A194S	possibly damaging	Het
Cacybp	T	C	1: 160,036,093 (GRCm39)	T32A	probably benign	Het
Cd82	A	G	2: 93,260,357 (GRCm39)	V90A	probably benign	Het
Cpb2	T	C	14: 75,512,519 (GRCm39)	Y311H	probably damaging	Het
Cyp39a1	T	C	17: 44,002,585 (GRCm39)	Y267H	probably benign	Het
Dnajc6	C	T	4: 101,492,262 (GRCm39)	Q766*	probably null	Het
Dusp3	T	C	11: 101,872,653 (GRCm39)	I48V	probably benign	Het
Eif3c	A	T	7: 126,146,672 (GRCm39)	F809I	probably damaging	Het
Exosc10	C	T	4: 148,647,329 (GRCm39)	P213S	probably benign	Het
Galns	C	T	8: 123,327,349 (GRCm39)	G141D	probably damaging	Het
Gm3233	A	T	10: 77,594,886 (GRCm39)		probably benign	Het
Hadha	A	T	5: 30,325,048 (GRCm39)	L714H	probably benign	Het
Map3k20	T	C	2: 72,198,763 (GRCm39)	M123T	probably damaging	Het
Nt5dc1	A	G	10: 34,200,365 (GRCm39)	L217P	probably damaging	Het
Nubp2	A	T	17: 25,104,577 (GRCm39)	D54E	probably damaging	Het
Onecut1	C	T	9: 74,770,497 (GRCm39)	R307C	probably damaging	Het
Or5b116	T	A	19: 13,422,989 (GRCm39)	D204E	probably benign	Het
Pcdhb17	A	G	18: 37,618,720 (GRCm39)	Y170C	probably damaging	Het
Pkd2	T	A	5: 104,637,159 (GRCm39)	C591S	probably damaging	Het
Pramel15	T	C	4: 144,103,409 (GRCm39)	N239S	probably benign	Het
Pwp2	A	T	10: 78,012,961 (GRCm39)	V549E	probably damaging	Het
Rapsn	A	T	2: 90,866,973 (GRCm39)	S92C	probably damaging	Het
Rbm19	A	G	5: 120,257,745 (GRCm39)	S90G	probably damaging	Het
Rfc1	G	A	5: 65,431,158 (GRCm39)		probably null	Het
Rims2	T	A	15: 39,381,208 (GRCm39)	F1046L	probably benign	Het
S100a16	C	T	3: 90,449,735 (GRCm39)	R73C	probably benign	Het
Shroom3	T	C	5: 93,089,928 (GRCm39)	Y893H	possibly damaging	Het
Stt3b	T	A	9: 115,096,388 (GRCm39)	Y253F	possibly damaging	Het
Taar8b	A	G	10: 23,967,160 (GRCm39)	*345Q	probably null	Het
Tas2r119	G	A	15: 32,177,676 (GRCm39)	V81I	probably benign	Het
Tas2r129	A	G	6: 132,928,128 (GRCm39)	I22V	probably benign	Het
Tbc1d19	T	G	5: 54,046,555 (GRCm39)		probably null	Het
Tnip3	A	T	6: 65,582,846 (GRCm39)	I218F	probably benign	Het
Tnks	A	T	8: 35,307,120 (GRCm39)		probably null	Het
Ttc29	T	C	8: 79,008,963 (GRCm39)	Y278H	possibly damaging	Het
Tut7	T	C	13: 59,947,753 (GRCm39)	E454G	possibly damaging	Het
Uba7	T	A	9: 107,854,213 (GRCm39)	C214*	probably null	Het
Vmn2r115	A	T	17: 23,578,572 (GRCm39)	I682F	probably benign	Het
Vmn2r75	A	T	7: 85,813,287 (GRCm39)	M505K	probably benign	Het
Wdr19	A	T	5: 65,415,466 (GRCm39)	T1313S	probably benign	Het
Zbtb22	A	G	17: 34,136,224 (GRCm39)	D123G	probably damaging	Het
Zdhhc7	A	G	8: 120,813,395 (GRCm39)	I138T	probably benign	Het
Zfp706	T	C	15: 37,004,045 (GRCm39)	K7R	unknown	Het
Zkscan3	G	A	13: 21,572,075 (GRCm39)	P519L	probably damaging	Het

Other mutations in Chd5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00537:Chd5	APN	4	152,445,059 (GRCm39)	missense	probably damaging	1.00
IGL00886:Chd5	APN	4	152,444,156 (GRCm39)	missense	probably benign	0.00
IGL00963:Chd5	APN	4	152,467,395 (GRCm39)	missense	probably damaging	1.00
IGL01399:Chd5	APN	4	152,441,144 (GRCm39)	missense	probably damaging	1.00
IGL01571:Chd5	APN	4	152,468,572 (GRCm39)	splice site	probably benign
IGL01606:Chd5	APN	4	152,445,432 (GRCm39)	missense	probably damaging	0.99
IGL01636:Chd5	APN	4	152,469,110 (GRCm39)	nonsense	probably null
IGL02009:Chd5	APN	4	152,450,670 (GRCm39)	missense	probably damaging	1.00
IGL02417:Chd5	APN	4	152,451,751 (GRCm39)	missense	probably damaging	0.97
IGL02504:Chd5	APN	4	152,447,779 (GRCm39)	missense	probably damaging	0.99
IGL02508:Chd5	APN	4	152,447,481 (GRCm39)	missense	probably damaging	1.00
IGL02597:Chd5	APN	4	152,456,169 (GRCm39)	missense	probably damaging	1.00
IGL02608:Chd5	APN	4	152,440,564 (GRCm39)	missense	possibly damaging	0.94
IGL02612:Chd5	APN	4	152,445,033 (GRCm39)	missense	probably damaging	1.00
IGL02658:Chd5	APN	4	152,445,050 (GRCm39)	missense	probably damaging	1.00
IGL02662:Chd5	APN	4	152,456,588 (GRCm39)	missense	probably damaging	1.00
IGL02676:Chd5	APN	4	152,440,530 (GRCm39)	splice site	probably benign
IGL02871:Chd5	APN	4	152,461,142 (GRCm39)	missense	probably damaging	1.00
IGL02942:Chd5	APN	4	152,470,182 (GRCm39)	missense	probably damaging	0.98
IGL02956:Chd5	APN	4	152,464,413 (GRCm39)	missense	probably benign	0.00
IGL03286:Chd5	APN	4	152,469,952 (GRCm39)	missense	probably benign	0.00
IGL03348:Chd5	APN	4	152,461,142 (GRCm39)	missense	probably damaging	1.00
IGL03398:Chd5	APN	4	152,461,539 (GRCm39)	missense	probably damaging	0.97
PIT1430001:Chd5	UTSW	4	152,455,094 (GRCm39)	missense	probably damaging	1.00
PIT4151001:Chd5	UTSW	4	152,462,986 (GRCm39)	missense	probably damaging	0.99
R0079:Chd5	UTSW	4	152,470,206 (GRCm39)	missense	probably damaging	1.00
R0241:Chd5	UTSW	4	152,450,589 (GRCm39)	missense	probably damaging	1.00
R0241:Chd5	UTSW	4	152,450,589 (GRCm39)	missense	probably damaging	1.00
R0379:Chd5	UTSW	4	152,467,778 (GRCm39)	missense	probably benign	0.00
R0388:Chd5	UTSW	4	152,456,101 (GRCm39)	missense	probably damaging	1.00
R0675:Chd5	UTSW	4	152,470,407 (GRCm39)	missense	probably benign	0.06
R0730:Chd5	UTSW	4	152,432,441 (GRCm39)	missense	possibly damaging	0.72
R0799:Chd5	UTSW	4	152,468,616 (GRCm39)	missense	probably damaging	1.00
R0800:Chd5	UTSW	4	152,440,614 (GRCm39)	missense	probably damaging	1.00
R1276:Chd5	UTSW	4	152,463,191 (GRCm39)	missense	probably damaging	1.00
R1752:Chd5	UTSW	4	152,459,590 (GRCm39)	missense	probably damaging	1.00
R1753:Chd5	UTSW	4	152,463,272 (GRCm39)	missense	probably damaging	1.00
R1843:Chd5	UTSW	4	152,470,263 (GRCm39)	missense	probably damaging	1.00
R1850:Chd5	UTSW	4	152,454,990 (GRCm39)	missense	probably damaging	1.00
R1851:Chd5	UTSW	4	152,462,727 (GRCm39)	missense	probably damaging	0.97
R1859:Chd5	UTSW	4	152,464,980 (GRCm39)	missense	probably benign	0.00
R1983:Chd5	UTSW	4	152,469,123 (GRCm39)	missense	possibly damaging	0.89
R2404:Chd5	UTSW	4	152,451,791 (GRCm39)	missense	probably damaging	1.00
R2897:Chd5	UTSW	4	152,456,572 (GRCm39)	missense	probably damaging	1.00
R2898:Chd5	UTSW	4	152,456,572 (GRCm39)	missense	probably damaging	1.00
R3893:Chd5	UTSW	4	152,445,113 (GRCm39)	missense	probably damaging	1.00
R3938:Chd5	UTSW	4	152,461,512 (GRCm39)	missense	probably benign	0.05
R4707:Chd5	UTSW	4	152,445,039 (GRCm39)	missense	probably damaging	1.00
R4754:Chd5	UTSW	4	152,462,203 (GRCm39)	missense	probably damaging	0.99
R4911:Chd5	UTSW	4	152,445,129 (GRCm39)	missense	probably damaging	1.00
R4924:Chd5	UTSW	4	152,450,886 (GRCm39)	missense	possibly damaging	0.50
R4926:Chd5	UTSW	4	152,467,768 (GRCm39)	missense	probably benign	0.00
R5256:Chd5	UTSW	4	152,456,554 (GRCm39)	missense	probably benign	0.01
R5524:Chd5	UTSW	4	152,461,087 (GRCm39)	missense	probably benign
R5552:Chd5	UTSW	4	152,470,272 (GRCm39)	missense	possibly damaging	0.95
R5895:Chd5	UTSW	4	152,464,389 (GRCm39)	missense	probably benign	0.13
R5945:Chd5	UTSW	4	152,464,408 (GRCm39)	missense	probably benign
R6007:Chd5	UTSW	4	152,463,878 (GRCm39)	missense	probably null	1.00
R6039:Chd5	UTSW	4	152,438,078 (GRCm39)	small deletion	probably benign
R6039:Chd5	UTSW	4	152,438,078 (GRCm39)	small deletion	probably benign
R6172:Chd5	UTSW	4	152,463,848 (GRCm39)	missense	probably damaging	1.00
R6173:Chd5	UTSW	4	152,463,848 (GRCm39)	missense	probably damaging	1.00
R6323:Chd5	UTSW	4	152,451,791 (GRCm39)	missense	probably damaging	0.99
R6331:Chd5	UTSW	4	152,466,865 (GRCm39)	missense	probably benign	0.02
R6528:Chd5	UTSW	4	152,441,133 (GRCm39)	missense	probably damaging	1.00
R6849:Chd5	UTSW	4	152,462,995 (GRCm39)	missense	probably damaging	1.00
R6854:Chd5	UTSW	4	152,467,395 (GRCm39)	missense	probably damaging	1.00
R6859:Chd5	UTSW	4	152,462,664 (GRCm39)	missense	probably damaging	1.00
R6999:Chd5	UTSW	4	152,458,891 (GRCm39)	missense	probably damaging	1.00
R7034:Chd5	UTSW	4	152,445,398 (GRCm39)	missense	possibly damaging	0.89
R7110:Chd5	UTSW	4	152,469,896 (GRCm39)	missense	probably damaging	1.00
R7361:Chd5	UTSW	4	152,447,745 (GRCm39)	missense	probably damaging	0.99
R7397:Chd5	UTSW	4	152,452,469 (GRCm39)	missense	possibly damaging	0.82
R7440:Chd5	UTSW	4	152,469,108 (GRCm39)	missense	probably benign	0.01
R7489:Chd5	UTSW	4	152,457,925 (GRCm39)	missense	probably damaging	1.00
R7810:Chd5	UTSW	4	152,443,032 (GRCm39)	missense	probably damaging	0.97
R8057:Chd5	UTSW	4	152,450,829 (GRCm39)	missense	probably damaging	1.00
R8078:Chd5	UTSW	4	152,445,448 (GRCm39)	missense	possibly damaging	0.90
R8092:Chd5	UTSW	4	152,463,261 (GRCm39)	missense	probably damaging	0.99
R8170:Chd5	UTSW	4	152,461,040 (GRCm39)	missense	probably benign	0.26
R8255:Chd5	UTSW	4	152,463,880 (GRCm39)	missense	probably damaging	0.99
R8348:Chd5	UTSW	4	152,445,173 (GRCm39)	missense	probably damaging	0.98
R8448:Chd5	UTSW	4	152,445,173 (GRCm39)	missense	probably damaging	0.98
R8478:Chd5	UTSW	4	152,441,147 (GRCm39)	nonsense	probably null
R8482:Chd5	UTSW	4	152,441,147 (GRCm39)	nonsense	probably null
R8670:Chd5	UTSW	4	152,469,953 (GRCm39)	missense	possibly damaging	0.81
R8733:Chd5	UTSW	4	152,463,923 (GRCm39)	missense	probably damaging	1.00
R8743:Chd5	UTSW	4	152,450,862 (GRCm39)	missense	probably benign	0.03
R8941:Chd5	UTSW	4	152,463,305 (GRCm39)	missense	possibly damaging	0.82
R8961:Chd5	UTSW	4	152,467,489 (GRCm39)	splice site	probably benign
R9103:Chd5	UTSW	4	152,461,444 (GRCm39)	missense	possibly damaging	0.62
R9160:Chd5	UTSW	4	152,469,916 (GRCm39)	missense	probably damaging	0.99
R9221:Chd5	UTSW	4	152,456,122 (GRCm39)	missense	probably damaging	0.96
R9399:Chd5	UTSW	4	152,468,592 (GRCm39)	missense	probably benign	0.06
R9429:Chd5	UTSW	4	152,447,364 (GRCm39)	missense	probably damaging	0.99
R9635:Chd5	UTSW	4	152,461,079 (GRCm39)	missense	possibly damaging	0.87
R9783:Chd5	UTSW	4	152,458,865 (GRCm39)	missense	probably damaging	1.00
Z1176:Chd5	UTSW	4	152,462,936 (GRCm39)	missense	probably damaging	0.98

Predicted Primers

PCR Primer
(F):5'- GGAAGGGCTTTTAGACAGACTGC -3'
(R):5'- AACCTGAGGTGGTGAAGCTG -3'

Sequencing Primer
(F):5'- CTTTTAGACAGACTGCCTGCGAAG -3'
(R):5'- AGACCTCGCCTGCTCAGAC -3'

Posted On

2018-06-06