Incidental Mutation 'R6536:Cd320'
ID 520439
Institutional Source Beutler Lab
Gene Symbol Cd320
Ensembl Gene ENSMUSG00000002308
Gene Name CD320 antigen
Synonyms 425O18-1, NG29, D17Ertd716e, VLDL, 8D6
MMRRC Submission 044662-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.115) question?
Stock # R6536 (G1)
Quality Score 205.009
Status Validated
Chromosome 17
Chromosomal Location 34062065-34068748 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 34066477 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 72 (S72P)
Ref Sequence ENSEMBL: ENSMUSP00000084839 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002379] [ENSMUST00000087559]
AlphaFold Q9Z1P5
Predicted Effect probably benign
Transcript: ENSMUST00000002379
AA Change: S86P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000002379
Gene: ENSMUSG00000002308
AA Change: S86P

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
LDLa 46 84 1.16e-14 SMART
LDLa 123 161 4.24e-8 SMART
transmembrane domain 207 229 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000087559
AA Change: S72P

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000084839
Gene: ENSMUSG00000002308
AA Change: S72P

DomainStartEndE-ValueType
signal peptide 1 30 N/A INTRINSIC
LDLa 32 70 1.16e-14 SMART
LDLa 109 147 4.24e-8 SMART
transmembrane domain 193 215 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173418
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.4%
Validation Efficiency 100% (36/36)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the transcobalamin receptor that is expressed at the cell surface. It mediates the cellular uptake of transcobalamin bound cobalamin (vitamin B12), and is involved in B-cell proliferation and immunoglobulin secretion. Mutations in this gene are associated with methylmalonic aciduria. Alternatively spliced transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Jan 2011]
PHENOTYPE: The homozygous mutant and heterozygous mice exhibited an increased mean retinal artery-to-vein ratio when compared with controls. Mice homozygous for a gene trap knock-out allele exhibit vitamin B12 deficiency in the central nervous system. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930111J21Rik2 G T 11: 48,910,550 (GRCm39) H628N probably benign Het
Abcb1a T A 5: 8,769,030 (GRCm39) F751I probably benign Het
Adamts13 G A 2: 26,865,762 (GRCm39) V106M probably damaging Het
Add1 C A 5: 34,758,780 (GRCm39) N31K possibly damaging Het
Adgrf5 G T 17: 43,733,552 (GRCm39) probably benign Het
Akap11 T G 14: 78,748,754 (GRCm39) D1211A possibly damaging Het
Atp5f1c G A 2: 10,085,127 (GRCm39) probably benign Het
Clca4b C A 3: 144,622,490 (GRCm39) W525L possibly damaging Het
Cripto A T 9: 110,773,257 (GRCm39) probably null Het
Csmd3 G A 15: 47,701,863 (GRCm39) T1740I probably damaging Het
Dnah7c T G 1: 46,697,450 (GRCm39) S2122A probably benign Het
Enpp2 T C 15: 54,726,027 (GRCm39) N583S probably damaging Het
Fcsk A G 8: 111,610,511 (GRCm39) V964A possibly damaging Het
Gpd2 A T 2: 57,235,367 (GRCm39) I366F probably benign Het
Hsd17b2 G A 8: 118,428,921 (GRCm39) V63M possibly damaging Het
Hsdl2 A T 4: 59,610,508 (GRCm39) probably null Het
Idh3b AG AGCACCACAACTG 2: 130,121,593 (GRCm39) probably null Het
Ifi44 A G 3: 151,438,126 (GRCm39) V387A probably benign Het
Kcnc4 T C 3: 107,355,512 (GRCm39) D312G possibly damaging Het
Kif1b T C 4: 149,277,053 (GRCm39) M1337V probably benign Het
Klra6 C T 6: 130,000,682 (GRCm39) V41I probably benign Het
Lrp1 A G 10: 127,393,937 (GRCm39) probably null Het
Mpdz T C 4: 81,301,654 (GRCm39) E257G probably damaging Het
Or10v1 T C 19: 11,873,760 (GRCm39) V125A probably benign Het
Or4f14 T C 2: 111,743,119 (GRCm39) D52G possibly damaging Het
Papln A G 12: 83,828,661 (GRCm39) Y789C probably damaging Het
Pcdh15 T C 10: 74,467,221 (GRCm39) L1680P probably damaging Het
Pcdhac1 A G 18: 37,223,367 (GRCm39) N60S probably benign Het
Polr3g T C 13: 81,826,335 (GRCm39) N162S unknown Het
Pou3f3 A G 1: 42,737,374 (GRCm39) I357V probably damaging Het
Sycp2 A G 2: 177,993,441 (GRCm39) S1235P probably damaging Het
Tns3 A T 11: 8,384,531 (GRCm39) V1429E probably damaging Het
Trim67 T C 8: 125,521,081 (GRCm39) S148P possibly damaging Het
Usp49 A T 17: 47,990,617 (GRCm39) I348F probably damaging Het
Wac A T 18: 7,905,189 (GRCm39) probably null Het
Zfp775 A G 6: 48,596,543 (GRCm39) K139R probably damaging Het
Other mutations in Cd320
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02002:Cd320 APN 17 34,062,214 (GRCm39) unclassified probably benign
R0107:Cd320 UTSW 17 34,067,059 (GRCm39) missense probably benign
R0722:Cd320 UTSW 17 34,065,004 (GRCm39) missense possibly damaging 0.65
R1272:Cd320 UTSW 17 34,067,138 (GRCm39) missense possibly damaging 0.53
R1515:Cd320 UTSW 17 34,066,613 (GRCm39) missense probably damaging 1.00
R4062:Cd320 UTSW 17 34,066,491 (GRCm39) missense probably benign 0.08
R4663:Cd320 UTSW 17 34,067,152 (GRCm39) missense probably null 1.00
R4981:Cd320 UTSW 17 34,066,549 (GRCm39) missense probably benign 0.00
R5516:Cd320 UTSW 17 34,067,021 (GRCm39) missense possibly damaging 0.95
R6376:Cd320 UTSW 17 34,066,491 (GRCm39) missense probably benign 0.08
R6600:Cd320 UTSW 17 34,066,591 (GRCm39) missense probably damaging 1.00
R7417:Cd320 UTSW 17 34,066,530 (GRCm39) nonsense probably null
R9668:Cd320 UTSW 17 34,065,113 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TAGGATTTAGAGCGGATTGGGTAAC -3'
(R):5'- CTGGAGTCAAGACAGTCTGG -3'

Sequencing Primer
(F):5'- CCTGGTCTACAAAGTGAGTTCCAG -3'
(R):5'- AAGACAGTCTGGGTGGCCATC -3'
Posted On 2018-06-06