Incidental Mutation 'R6495:Uba7'
ID520440
Institutional Source Beutler Lab
Gene Symbol Uba7
Ensembl Gene ENSMUSG00000032596
Gene Nameubiquitin-like modifier activating enzyme 7
Synonyms1300004C08Rik, Ube1l
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.156) question?
Stock #R6495 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location107975505-107984060 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 107977014 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Stop codon at position 214 (C214*)
Ref Sequence ENSEMBL: ENSMUSP00000134910 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035216] [ENSMUST00000049348] [ENSMUST00000177392]
Predicted Effect probably null
Transcript: ENSMUST00000035216
AA Change: C214*
SMART Domains Protein: ENSMUSP00000035216
Gene: ENSMUSG00000032596
AA Change: C214*

DomainStartEndE-ValueType
Pfam:ThiF 6 401 1.2e-33 PFAM
Pfam:E1_FCCH 178 249 1.1e-26 PFAM
Pfam:E1_4HB 250 318 2.5e-22 PFAM
internal_repeat_1 402 510 8.05e-5 PROSPERO
Pfam:UBA_e1_thiolCys 592 808 1.3e-50 PFAM
UBA_e1_C 846 973 4.63e-65 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000049348
SMART Domains Protein: ENSMUSP00000040001
Gene: ENSMUSG00000032586

DomainStartEndE-ValueType
RING 7 49 6.68e-6 SMART
coiled coil region 70 278 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000075082
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175933
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176037
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176478
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176673
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176743
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176842
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176858
Predicted Effect probably benign
Transcript: ENSMUST00000177039
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177096
Predicted Effect probably null
Transcript: ENSMUST00000177392
AA Change: C214*
SMART Domains Protein: ENSMUSP00000134910
Gene: ENSMUSG00000032596
AA Change: C214*

DomainStartEndE-ValueType
Pfam:ThiF 22 153 1.2e-18 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177494
Meta Mutation Damage Score 0.606 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.8%
Validation Efficiency 100% (50/50)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The modification of proteins with ubiquitin is an important cellular mechanism for targeting abnormal or short-lived proteins for degradation. Ubiquitination involves at least three classes of enzymes: ubiquitin-activating enzymes, or E1s, ubiquitin-conjugating enzymes, or E2s, and ubiquitin-protein ligases, or E3s. This gene encodes a member of the E1 ubiquitin-activating enzyme family. The encoded enzyme is a retinoid target that triggers promyelocytic leukemia (PML)/retinoic acid receptor alpha (RARalpha) degradation and apoptosis in acute promyelocytic leukemia, where it is involved in the conjugation of the ubiquitin-like interferon-stimulated gene 15 protein. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice lacking ISG15 conjugation but not free ISG15 are healthy and fertile and exhibit normal antiviral responses against vesicular stomatitis virus and lymphocytic choriomeningitis virus infection. Bone-derived macrophages from mutant mice display normal responses to IFN treatment. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ahnak2 T A 12: 112,773,714 E502V probably damaging Het
Apbb1ip T A 2: 22,853,120 Y321* probably null Het
Apob A G 12: 7,990,394 K577R probably null Het
Arfgef3 A G 10: 18,611,202 probably null Het
Asap3 T A 4: 136,228,479 probably null Het
Atp13a5 C T 16: 29,321,622 probably null Het
Bcan C A 3: 87,996,597 A194S possibly damaging Het
Cacybp T C 1: 160,208,523 T32A probably benign Het
Cd82 A G 2: 93,430,012 V90A probably benign Het
Chd5 C T 4: 152,367,372 R714C probably damaging Het
Cpb2 T C 14: 75,275,079 Y311H probably damaging Het
Cyp39a1 T C 17: 43,691,694 Y267H probably benign Het
Dnajc6 C T 4: 101,635,065 Q766* probably null Het
Dusp3 T C 11: 101,981,827 I48V probably benign Het
Eif3c A T 7: 126,547,500 F809I probably damaging Het
Exosc10 C T 4: 148,562,872 P213S probably benign Het
Galns C T 8: 122,600,610 G141D probably damaging Het
Gm3233 A T 10: 77,759,052 probably benign Het
Hadha A T 5: 30,120,050 L714H probably benign Het
Map3k20 T C 2: 72,368,419 M123T probably damaging Het
Nt5dc1 A G 10: 34,324,369 L217P probably damaging Het
Nubp2 A T 17: 24,885,603 D54E probably damaging Het
Olfr1471 T A 19: 13,445,625 D204E probably benign Het
Onecut1 C T 9: 74,863,215 R307C probably damaging Het
Pcdhb17 A G 18: 37,485,667 Y170C probably damaging Het
Pkd2 T A 5: 104,489,293 C591S probably damaging Het
Pramef20 T C 4: 144,376,839 N239S probably benign Het
Pwp2 A T 10: 78,177,127 V549E probably damaging Het
Rapsn A T 2: 91,036,628 S92C probably damaging Het
Rbm19 A G 5: 120,119,680 S90G probably damaging Het
Rfc1 G A 5: 65,273,815 probably null Het
Rims2 T A 15: 39,517,812 F1046L probably benign Het
S100a16 C T 3: 90,542,428 R73C probably benign Het
Shroom3 T C 5: 92,942,069 Y893H possibly damaging Het
Stt3b T A 9: 115,267,320 Y253F possibly damaging Het
Taar8b A G 10: 24,091,262 *345Q probably null Het
Tas2r119 G A 15: 32,177,530 V81I probably benign Het
Tas2r129 A G 6: 132,951,165 I22V probably benign Het
Tbc1d19 T G 5: 53,889,213 probably null Het
Tnip3 A T 6: 65,605,862 I218F probably benign Het
Tnks A T 8: 34,839,966 probably null Het
Ttc29 T C 8: 78,282,334 Y278H possibly damaging Het
Vmn2r115 A T 17: 23,359,598 I682F probably benign Het
Vmn2r75 A T 7: 86,164,079 M505K probably benign Het
Wdr19 A T 5: 65,258,123 T1313S probably benign Het
Zbtb22 A G 17: 33,917,250 D123G probably damaging Het
Zcchc6 T C 13: 59,799,939 E454G possibly damaging Het
Zdhhc7 A G 8: 120,086,656 I138T probably benign Het
Zfp706 T C 15: 37,003,801 K7R unknown Het
Zkscan3 G A 13: 21,387,905 P519L probably damaging Het
Other mutations in Uba7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00157:Uba7 APN 9 107979111 missense probably benign 0.31
IGL01696:Uba7 APN 9 107977348 missense probably damaging 1.00
IGL02137:Uba7 APN 9 107979753 splice site probably benign
IGL02272:Uba7 APN 9 107976153 missense probably benign 0.01
IGL02287:Uba7 APN 9 107978227 missense probably benign 0.10
IGL02430:Uba7 APN 9 107979468 splice site probably benign
IGL02552:Uba7 APN 9 107981390 missense probably benign 0.00
IGL02820:Uba7 APN 9 107981516 missense probably benign 0.01
IGL03234:Uba7 APN 9 107976400 missense probably damaging 0.97
R0013:Uba7 UTSW 9 107978249 missense probably damaging 1.00
R0013:Uba7 UTSW 9 107978249 missense probably damaging 1.00
R0717:Uba7 UTSW 9 107977217 missense probably benign 0.44
R2108:Uba7 UTSW 9 107979288 missense probably benign
R2253:Uba7 UTSW 9 107976364 missense probably benign 0.26
R4239:Uba7 UTSW 9 107976802 critical splice donor site probably null
R4528:Uba7 UTSW 9 107983903 missense possibly damaging 0.79
R4735:Uba7 UTSW 9 107976916 missense possibly damaging 0.94
R4736:Uba7 UTSW 9 107980165 missense probably benign 0.00
R4751:Uba7 UTSW 9 107979805 missense possibly damaging 0.66
R4937:Uba7 UTSW 9 107978991 missense possibly damaging 0.95
R4999:Uba7 UTSW 9 107979839 critical splice donor site probably null
R5020:Uba7 UTSW 9 107978914 missense probably benign
R5157:Uba7 UTSW 9 107980047 missense probably benign 0.04
R5214:Uba7 UTSW 9 107977514 intron probably benign
R5339:Uba7 UTSW 9 107978866 missense probably damaging 1.00
R5990:Uba7 UTSW 9 107981234 missense probably damaging 0.96
R6092:Uba7 UTSW 9 107983160 missense possibly damaging 0.96
R6110:Uba7 UTSW 9 107978939 missense probably benign 0.25
R6363:Uba7 UTSW 9 107980183 critical splice donor site probably null
R6644:Uba7 UTSW 9 107981472 missense possibly damaging 0.55
R7032:Uba7 UTSW 9 107976172 missense possibly damaging 0.83
R7095:Uba7 UTSW 9 107983339 missense probably benign 0.01
X0024:Uba7 UTSW 9 107975945 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCTCAGATGTAGAGGTTTCCC -3'
(R):5'- TTGACTTCGGTGACAACCCC -3'

Sequencing Primer
(F):5'- TTCCCTGATGTCCAGAGAAAG -3'
(R):5'- CACCTCTCAAGTAACGGGAG -3'
Posted On2018-06-06