Incidental Mutation 'R6495:Stt3b'
ID520442
Institutional Source Beutler Lab
Gene Symbol Stt3b
Ensembl Gene ENSMUSG00000032437
Gene NameSTT3, subunit of the oligosaccharyltransferase complex, homolog B (S. cerevisiae)
Synonyms1300006C19Rik, Simp
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.755) question?
Stock #R6495 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location115242581-115310421 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 115267320 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 253 (Y253F)
Ref Sequence ENSEMBL: ENSMUSP00000035010 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035010]
Predicted Effect possibly damaging
Transcript: ENSMUST00000035010
AA Change: Y253F

PolyPhen 2 Score 0.464 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000035010
Gene: ENSMUSG00000032437
AA Change: Y253F

DomainStartEndE-ValueType
low complexity region 40 60 N/A INTRINSIC
Pfam:STT3 68 560 2e-151 PFAM
low complexity region 807 821 N/A INTRINSIC
Meta Mutation Damage Score 0.432 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.8%
Validation Efficiency 100% (50/50)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a catalytic subunit of a protein complex that transfers oligosaccharides onto asparagine residues. Defects in this gene are a cause of congenital disorder of glycosylation Ix (CDG1X). [provided by RefSeq, Jun 2014]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ahnak2 T A 12: 112,773,714 E502V probably damaging Het
Apbb1ip T A 2: 22,853,120 Y321* probably null Het
Apob A G 12: 7,990,394 K577R probably null Het
Arfgef3 A G 10: 18,611,202 probably null Het
Asap3 T A 4: 136,228,479 probably null Het
Atp13a5 C T 16: 29,321,622 probably null Het
Bcan C A 3: 87,996,597 A194S possibly damaging Het
Cacybp T C 1: 160,208,523 T32A probably benign Het
Cd82 A G 2: 93,430,012 V90A probably benign Het
Chd5 C T 4: 152,367,372 R714C probably damaging Het
Cpb2 T C 14: 75,275,079 Y311H probably damaging Het
Cyp39a1 T C 17: 43,691,694 Y267H probably benign Het
Dnajc6 C T 4: 101,635,065 Q766* probably null Het
Dusp3 T C 11: 101,981,827 I48V probably benign Het
Eif3c A T 7: 126,547,500 F809I probably damaging Het
Exosc10 C T 4: 148,562,872 P213S probably benign Het
Galns C T 8: 122,600,610 G141D probably damaging Het
Gm3233 A T 10: 77,759,052 probably benign Het
Hadha A T 5: 30,120,050 L714H probably benign Het
Map3k20 T C 2: 72,368,419 M123T probably damaging Het
Nt5dc1 A G 10: 34,324,369 L217P probably damaging Het
Nubp2 A T 17: 24,885,603 D54E probably damaging Het
Olfr1471 T A 19: 13,445,625 D204E probably benign Het
Onecut1 C T 9: 74,863,215 R307C probably damaging Het
Pcdhb17 A G 18: 37,485,667 Y170C probably damaging Het
Pkd2 T A 5: 104,489,293 C591S probably damaging Het
Pramef20 T C 4: 144,376,839 N239S probably benign Het
Pwp2 A T 10: 78,177,127 V549E probably damaging Het
Rapsn A T 2: 91,036,628 S92C probably damaging Het
Rbm19 A G 5: 120,119,680 S90G probably damaging Het
Rfc1 G A 5: 65,273,815 probably null Het
Rims2 T A 15: 39,517,812 F1046L probably benign Het
S100a16 C T 3: 90,542,428 R73C probably benign Het
Shroom3 T C 5: 92,942,069 Y893H possibly damaging Het
Taar8b A G 10: 24,091,262 *345Q probably null Het
Tas2r119 G A 15: 32,177,530 V81I probably benign Het
Tas2r129 A G 6: 132,951,165 I22V probably benign Het
Tbc1d19 T G 5: 53,889,213 probably null Het
Tnip3 A T 6: 65,605,862 I218F probably benign Het
Tnks A T 8: 34,839,966 probably null Het
Ttc29 T C 8: 78,282,334 Y278H possibly damaging Het
Uba7 T A 9: 107,977,014 C214* probably null Het
Vmn2r115 A T 17: 23,359,598 I682F probably benign Het
Vmn2r75 A T 7: 86,164,079 M505K probably benign Het
Wdr19 A T 5: 65,258,123 T1313S probably benign Het
Zbtb22 A G 17: 33,917,250 D123G probably damaging Het
Zcchc6 T C 13: 59,799,939 E454G possibly damaging Het
Zdhhc7 A G 8: 120,086,656 I138T probably benign Het
Zfp706 T C 15: 37,003,801 K7R unknown Het
Zkscan3 G A 13: 21,387,905 P519L probably damaging Het
Other mutations in Stt3b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00481:Stt3b APN 9 115251847 missense probably benign 0.42
IGL00929:Stt3b APN 9 115266165 missense probably damaging 1.00
IGL01333:Stt3b APN 9 115257544 missense probably damaging 0.97
IGL01389:Stt3b APN 9 115253900 missense probably benign
IGL01680:Stt3b APN 9 115246261 splice site probably benign
IGL01980:Stt3b APN 9 115276699 splice site probably null
IGL02351:Stt3b APN 9 115250907 missense possibly damaging 0.90
IGL02358:Stt3b APN 9 115250907 missense possibly damaging 0.90
IGL02421:Stt3b APN 9 115251852 splice site probably benign
IGL02602:Stt3b APN 9 115276778 missense probably damaging 1.00
IGL03231:Stt3b APN 9 115243994 missense unknown
R0482:Stt3b UTSW 9 115248567 missense probably benign 0.10
R1221:Stt3b UTSW 9 115257499 missense probably benign 0.00
R1437:Stt3b UTSW 9 115254927 missense probably damaging 1.00
R1477:Stt3b UTSW 9 115266192 missense probably damaging 1.00
R1604:Stt3b UTSW 9 115250927 missense probably damaging 1.00
R1796:Stt3b UTSW 9 115248607 nonsense probably null
R4112:Stt3b UTSW 9 115266138 missense probably damaging 1.00
R4166:Stt3b UTSW 9 115254901 missense probably damaging 1.00
R4695:Stt3b UTSW 9 115254794 missense probably damaging 1.00
R5183:Stt3b UTSW 9 115266143 missense probably damaging 0.99
R5317:Stt3b UTSW 9 115252510 nonsense probably null
R5631:Stt3b UTSW 9 115254845 missense probably benign 0.05
R5665:Stt3b UTSW 9 115266147 missense probably damaging 1.00
R6517:Stt3b UTSW 9 115267342 missense probably benign
R6525:Stt3b UTSW 9 115258558 missense probably damaging 1.00
R6593:Stt3b UTSW 9 115252511 missense probably damaging 0.99
R7065:Stt3b UTSW 9 115266156 missense probably damaging 1.00
R7071:Stt3b UTSW 9 115254017 missense probably damaging 1.00
R7297:Stt3b UTSW 9 115276957 missense probably damaging 1.00
R7313:Stt3b UTSW 9 115266115 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AAGGTCTTTCAGAATCAGCTTGTTC -3'
(R):5'- AGGCTCCAGTTTATTGACATTAACC -3'

Sequencing Primer
(F):5'- TCAGAATCAGCTTGTTCTAATTCAG -3'
(R):5'- TTTCATGGCAGAAAATGAAAACAG -3'
Posted On2018-06-06