Incidental Mutation 'R6495:Zkscan3'
ID520459
Institutional Source Beutler Lab
Gene Symbol Zkscan3
Ensembl Gene ENSMUSG00000021327
Gene Namezinc finger with KRAB and SCAN domains 3
SynonymsZfp306, 2810435N07Rik, Zfp307, Skz1
MMRRC Submission
Accession Numbers

Genbank: NM_001145778, NM_023685; MGI: 1919989

Is this an essential gene? Probably non essential (E-score: 0.098) question?
Stock #R6495 (G1)
Quality Score225.009
Status Validated
Chromosome13
Chromosomal Location21387003-21402755 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 21387905 bp
ZygosityHeterozygous
Amino Acid Change Proline to Leucine at position 519 (P519L)
Ref Sequence ENSEMBL: ENSMUSP00000112135 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070785] [ENSMUST00000116434] [ENSMUST00000117721] [ENSMUST00000223831] [ENSMUST00000224820]
Predicted Effect probably damaging
Transcript: ENSMUST00000070785
AA Change: P519L

PolyPhen 2 Score 0.966 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000068424
Gene: ENSMUSG00000021327
AA Change: P519L

DomainStartEndE-ValueType
SCAN 47 159 4.18e-71 SMART
KRAB 213 273 4.07e-6 SMART
ZnF_C2H2 313 335 4.17e-3 SMART
ZnF_C2H2 341 363 1.38e-3 SMART
ZnF_C2H2 369 391 9.88e-5 SMART
ZnF_C2H2 397 419 1.95e-3 SMART
ZnF_C2H2 425 447 3.95e-4 SMART
ZnF_C2H2 479 501 5.21e-4 SMART
ZnF_C2H2 507 529 1.2e-3 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000116434
AA Change: P519L

PolyPhen 2 Score 0.966 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000112135
Gene: ENSMUSG00000021327
AA Change: P519L

DomainStartEndE-ValueType
SCAN 47 159 4.18e-71 SMART
KRAB 213 273 4.07e-6 SMART
ZnF_C2H2 313 335 4.17e-3 SMART
ZnF_C2H2 341 363 1.38e-3 SMART
ZnF_C2H2 369 391 9.88e-5 SMART
ZnF_C2H2 397 419 1.95e-3 SMART
ZnF_C2H2 425 447 3.95e-4 SMART
ZnF_C2H2 479 501 5.21e-4 SMART
ZnF_C2H2 507 529 1.2e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000117721
SMART Domains Protein: ENSMUSP00000112862
Gene: ENSMUSG00000021327

DomainStartEndE-ValueType
SCAN 47 159 4.18e-71 SMART
KRAB 213 256 3.96e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145631
Predicted Effect probably benign
Transcript: ENSMUST00000223831
AA Change: P352L

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
Predicted Effect probably benign
Transcript: ENSMUST00000224820
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.8%
Validation Efficiency 100% (50/50)
Allele List at MGI

All alleles(5) : Gene trapped(5)

Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ahnak2 T A 12: 112,773,714 E502V probably damaging Het
Apbb1ip T A 2: 22,853,120 Y321* probably null Het
Apob A G 12: 7,990,394 K577R probably null Het
Arfgef3 A G 10: 18,611,202 probably null Het
Asap3 T A 4: 136,228,479 probably null Het
Atp13a5 C T 16: 29,321,622 probably null Het
Bcan C A 3: 87,996,597 A194S possibly damaging Het
Cacybp T C 1: 160,208,523 T32A probably benign Het
Cd82 A G 2: 93,430,012 V90A probably benign Het
Chd5 C T 4: 152,367,372 R714C probably damaging Het
Cpb2 T C 14: 75,275,079 Y311H probably damaging Het
Cyp39a1 T C 17: 43,691,694 Y267H probably benign Het
Dnajc6 C T 4: 101,635,065 Q766* probably null Het
Dusp3 T C 11: 101,981,827 I48V probably benign Het
Eif3c A T 7: 126,547,500 F809I probably damaging Het
Exosc10 C T 4: 148,562,872 P213S probably benign Het
Galns C T 8: 122,600,610 G141D probably damaging Het
Gm3233 A T 10: 77,759,052 probably benign Het
Hadha A T 5: 30,120,050 L714H probably benign Het
Map3k20 T C 2: 72,368,419 M123T probably damaging Het
Nt5dc1 A G 10: 34,324,369 L217P probably damaging Het
Nubp2 A T 17: 24,885,603 D54E probably damaging Het
Olfr1471 T A 19: 13,445,625 D204E probably benign Het
Onecut1 C T 9: 74,863,215 R307C probably damaging Het
Pcdhb17 A G 18: 37,485,667 Y170C probably damaging Het
Pkd2 T A 5: 104,489,293 C591S probably damaging Het
Pramef20 T C 4: 144,376,839 N239S probably benign Het
Pwp2 A T 10: 78,177,127 V549E probably damaging Het
Rapsn A T 2: 91,036,628 S92C probably damaging Het
Rbm19 A G 5: 120,119,680 S90G probably damaging Het
Rfc1 G A 5: 65,273,815 probably null Het
Rims2 T A 15: 39,517,812 F1046L probably benign Het
S100a16 C T 3: 90,542,428 R73C probably benign Het
Shroom3 T C 5: 92,942,069 Y893H possibly damaging Het
Stt3b T A 9: 115,267,320 Y253F possibly damaging Het
Taar8b A G 10: 24,091,262 *345Q probably null Het
Tas2r119 G A 15: 32,177,530 V81I probably benign Het
Tas2r129 A G 6: 132,951,165 I22V probably benign Het
Tbc1d19 T G 5: 53,889,213 probably null Het
Tnip3 A T 6: 65,605,862 I218F probably benign Het
Tnks A T 8: 34,839,966 probably null Het
Ttc29 T C 8: 78,282,334 Y278H possibly damaging Het
Uba7 T A 9: 107,977,014 C214* probably null Het
Vmn2r115 A T 17: 23,359,598 I682F probably benign Het
Vmn2r75 A T 7: 86,164,079 M505K probably benign Het
Wdr19 A T 5: 65,258,123 T1313S probably benign Het
Zbtb22 A G 17: 33,917,250 D123G probably damaging Het
Zcchc6 T C 13: 59,799,939 E454G possibly damaging Het
Zdhhc7 A G 8: 120,086,656 I138T probably benign Het
Zfp706 T C 15: 37,003,801 K7R unknown Het
Other mutations in Zkscan3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01574:Zkscan3 APN 13 21394091 splice site probably benign
IGL02406:Zkscan3 APN 13 21388178 missense possibly damaging 0.71
IGL02725:Zkscan3 APN 13 21394893 missense possibly damaging 0.85
IGL02741:Zkscan3 APN 13 21393994 missense probably benign 0.05
3-1:Zkscan3 UTSW 13 21387881 missense probably benign 0.32
R0040:Zkscan3 UTSW 13 21394920 splice site probably null
R0040:Zkscan3 UTSW 13 21394920 splice site probably null
R0133:Zkscan3 UTSW 13 21394774 missense possibly damaging 0.73
R0660:Zkscan3 UTSW 13 21388460 missense probably damaging 1.00
R0737:Zkscan3 UTSW 13 21388596 missense probably benign
R1250:Zkscan3 UTSW 13 21388524 missense probably benign 0.32
R1671:Zkscan3 UTSW 13 21396135 missense possibly damaging 0.93
R1926:Zkscan3 UTSW 13 21396446 missense possibly damaging 0.88
R2899:Zkscan3 UTSW 13 21393973 missense probably damaging 1.00
R4119:Zkscan3 UTSW 13 21393949 missense possibly damaging 0.65
R4120:Zkscan3 UTSW 13 21393949 missense possibly damaging 0.65
R4606:Zkscan3 UTSW 13 21393783 missense probably benign 0.00
R5459:Zkscan3 UTSW 13 21394812 missense probably damaging 0.96
R5549:Zkscan3 UTSW 13 21394063 missense probably damaging 1.00
R5631:Zkscan3 UTSW 13 21394533 missense probably damaging 1.00
R5988:Zkscan3 UTSW 13 21396291 missense probably damaging 1.00
R7286:Zkscan3 UTSW 13 21394813 missense probably benign
R7363:Zkscan3 UTSW 13 21387822 missense probably damaging 0.99
R7443:Zkscan3 UTSW 13 21388438 nonsense probably null
Z1088:Zkscan3 UTSW 13 21388565 missense possibly damaging 0.53
Predicted Primers PCR Primer
(F):5'- TTCCAATGGGTGAGGACTCTTG -3'
(R):5'- CCTTACTGGGAAAGTCAGAGTAGG -3'

Sequencing Primer
(F):5'- GTGAGGACTCTTGTAGACAACTC -3'
(R):5'- TCAGAGTAGGGTGGAAAGCC -3'
Posted On2018-06-06