Incidental Mutation 'R6537:Gm43302'
ID520471
Institutional Source Beutler Lab
Gene Symbol Gm43302
Ensembl Gene ENSMUSG00000079362
Gene Namepredicted gene 43302
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.053) question?
Stock #R6537 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location105214907-105293695 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 105290995 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 9 (I9T)
Ref Sequence ENSEMBL: ENSMUSP00000142994 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050011] [ENSMUST00000196520] [ENSMUST00000200045]
Predicted Effect possibly damaging
Transcript: ENSMUST00000050011
AA Change: I9T

PolyPhen 2 Score 0.934 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000062528
Gene: ENSMUSG00000079362
AA Change: I9T

DomainStartEndE-ValueType
Pfam:GBP 16 279 7.6e-118 PFAM
Pfam:GBP_C 281 575 2.1e-117 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000196520
AA Change: I9T

PolyPhen 2 Score 0.934 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000142518
Gene: ENSMUSG00000104713
AA Change: I9T

DomainStartEndE-ValueType
Pfam:GBP 16 279 2.8e-124 PFAM
Pfam:GBP_C 281 575 2.1e-117 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199944
Predicted Effect possibly damaging
Transcript: ENSMUST00000200045
AA Change: I9T

PolyPhen 2 Score 0.941 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000142994
Gene: ENSMUSG00000104713
AA Change: I9T

DomainStartEndE-ValueType
Pfam:GBP 16 62 7.4e-19 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency 100% (30/30)
Allele List at MGI
Other mutations in this stock
Total: 29 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Anapc4 T C 5: 52,843,556 S224P probably damaging Het
Col6a4 G A 9: 106,067,954 T987M possibly damaging Het
Cort C T 4: 149,126,624 G8E probably benign Het
Ctdp1 G T 18: 80,449,551 D576E probably benign Het
Ctsq A T 13: 61,035,326 I334N probably damaging Het
Cwc15 A G 9: 14,501,988 D22G probably damaging Het
Dnmt3l G A 10: 78,052,064 G136R probably null Het
Fam19a2 T A 10: 123,593,496 M5K possibly damaging Het
Fxyd6 A G 9: 45,390,794 I37V possibly damaging Het
Gm10604 A C 4: 11,980,221 S28A unknown Het
Hmcn2 T C 2: 31,415,268 V3151A probably benign Het
Kif1b T C 4: 149,192,596 M1337V probably benign Het
Kyat3 A G 3: 142,729,812 T282A probably benign Het
Lrp6 T C 6: 134,480,495 E782G probably benign Het
Lrrc3b T C 14: 15,357,946 Y220C probably damaging Het
Macf1 C T 4: 123,492,725 S1033N probably damaging Het
Mdm1 A G 10: 118,158,576 T452A probably benign Het
Nrn1l G T 8: 105,894,718 R99L probably damaging Het
Pappa T A 4: 65,297,282 I1142N probably damaging Het
Pcsk1 T C 13: 75,132,239 F728L probably damaging Het
Ptcd3 T C 6: 71,897,110 probably null Het
Siglecf C T 7: 43,355,999 T461I probably benign Het
Slc7a8 C T 14: 54,735,119 A282T probably benign Het
Srcap T C 7: 127,542,220 V1724A probably damaging Het
Tek A G 4: 94,837,324 Q609R probably benign Het
Trim45 C T 3: 100,925,396 A315V probably benign Het
Ttbk1 C T 17: 46,470,310 V446M probably damaging Het
Wrap53 T C 11: 69,563,868 D225G possibly damaging Het
Znhit6 A G 3: 145,594,619 I193V probably benign Het
Other mutations in Gm43302
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0033:Gm43302 UTSW 5 105276844 missense probably benign 0.12
R0066:Gm43302 UTSW 5 105290900 missense probably damaging 1.00
R0764:Gm43302 UTSW 5 105280489 missense probably benign
R1400:Gm43302 UTSW 5 105274756 missense probably damaging 1.00
R1421:Gm43302 UTSW 5 105217349 missense probably benign
R1539:Gm43302 UTSW 5 105274769 missense probably benign 0.02
R1774:Gm43302 UTSW 5 105275794 missense probably benign 0.01
R1842:Gm43302 UTSW 5 105277736 missense probably benign 0.01
R2011:Gm43302 UTSW 5 105290980 missense probably damaging 1.00
R2131:Gm43302 UTSW 5 105274744 missense probably damaging 0.99
R2174:Gm43302 UTSW 5 105274350 missense probably benign 0.12
R3687:Gm43302 UTSW 5 105280266 missense probably damaging 1.00
R5322:Gm43302 UTSW 5 105217481 missense probably benign 0.00
R5396:Gm43302 UTSW 5 105280089 nonsense probably null
R5668:Gm43302 UTSW 5 105275812 missense probably benign
R5723:Gm43302 UTSW 5 105217486 missense possibly damaging 0.89
R6073:Gm43302 UTSW 5 105290959 missense probably damaging 0.96
R6159:Gm43302 UTSW 5 105289028 missense probably benign 0.11
R6225:Gm43302 UTSW 5 105277739 nonsense probably null
R6483:Gm43302 UTSW 5 105275860 missense probably benign 0.01
R6678:Gm43302 UTSW 5 105290954 missense probably benign 0.14
R6889:Gm43302 UTSW 5 105280138 missense probably benign 0.00
R7163:Gm43302 UTSW 5 105293627 splice site probably null
Predicted Primers PCR Primer
(F):5'- CAAACCTTTGGCTGGTAGGC -3'
(R):5'- AAGAGAAGCAGGCCCTCTGTAC -3'

Sequencing Primer
(F):5'- CAGCATGCCACTCACCGTG -3'
(R):5'- ACTGCAGATTCGAGGTTACATGC -3'
Posted On2018-06-06