Incidental Mutation 'R6537:Ptcd3'
ID520473
Institutional Source Beutler Lab
Gene Symbol Ptcd3
Ensembl Gene ENSMUSG00000063884
Gene Namepentatricopeptide repeat domain 3
Synonyms2610034F17Rik, 2810422B04Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6537 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location71880638-71908750 bp(-) (GRCm38)
Type of Mutationsplice site (3 bp from exon)
DNA Base Change (assembly) T to C at 71897110 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000080743 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000082094] [ENSMUST00000206879]
Predicted Effect probably null
Transcript: ENSMUST00000082094
SMART Domains Protein: ENSMUSP00000080743
Gene: ENSMUSG00000063884

DomainStartEndE-ValueType
low complexity region 2 8 N/A INTRINSIC
low complexity region 216 227 N/A INTRINSIC
Pfam:PPR_2 253 300 1.4e-10 PFAM
Pfam:PPR_3 331 366 2.1e-4 PFAM
low complexity region 671 684 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205293
Predicted Effect probably benign
Transcript: ENSMUST00000205556
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205761
Predicted Effect probably benign
Transcript: ENSMUST00000206284
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206631
Predicted Effect probably benign
Transcript: ENSMUST00000206879
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency 100% (30/30)
Allele List at MGI
Other mutations in this stock
Total: 29 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Anapc4 T C 5: 52,843,556 S224P probably damaging Het
Col6a4 G A 9: 106,067,954 T987M possibly damaging Het
Cort C T 4: 149,126,624 G8E probably benign Het
Ctdp1 G T 18: 80,449,551 D576E probably benign Het
Ctsq A T 13: 61,035,326 I334N probably damaging Het
Cwc15 A G 9: 14,501,988 D22G probably damaging Het
Dnmt3l G A 10: 78,052,064 G136R probably null Het
Fam19a2 T A 10: 123,593,496 M5K possibly damaging Het
Fxyd6 A G 9: 45,390,794 I37V possibly damaging Het
Gm10604 A C 4: 11,980,221 S28A unknown Het
Gm43302 A G 5: 105,290,995 I9T possibly damaging Het
Hmcn2 T C 2: 31,415,268 V3151A probably benign Het
Kif1b T C 4: 149,192,596 M1337V probably benign Het
Kyat3 A G 3: 142,729,812 T282A probably benign Het
Lrp6 T C 6: 134,480,495 E782G probably benign Het
Lrrc3b T C 14: 15,357,946 Y220C probably damaging Het
Macf1 C T 4: 123,492,725 S1033N probably damaging Het
Mdm1 A G 10: 118,158,576 T452A probably benign Het
Nrn1l G T 8: 105,894,718 R99L probably damaging Het
Pappa T A 4: 65,297,282 I1142N probably damaging Het
Pcsk1 T C 13: 75,132,239 F728L probably damaging Het
Siglecf C T 7: 43,355,999 T461I probably benign Het
Slc7a8 C T 14: 54,735,119 A282T probably benign Het
Srcap T C 7: 127,542,220 V1724A probably damaging Het
Tek A G 4: 94,837,324 Q609R probably benign Het
Trim45 C T 3: 100,925,396 A315V probably benign Het
Ttbk1 C T 17: 46,470,310 V446M probably damaging Het
Wrap53 T C 11: 69,563,868 D225G possibly damaging Het
Znhit6 A G 3: 145,594,619 I193V probably benign Het
Other mutations in Ptcd3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00767:Ptcd3 APN 6 71903448 missense probably damaging 0.96
IGL00903:Ptcd3 APN 6 71907844 missense possibly damaging 0.93
IGL01545:Ptcd3 APN 6 71888577 missense probably benign 0.01
IGL01924:Ptcd3 APN 6 71898427 missense probably damaging 1.00
IGL02675:Ptcd3 APN 6 71883442 critical splice donor site probably null
R0732:Ptcd3 UTSW 6 71881171 unclassified probably benign
R1374:Ptcd3 UTSW 6 71908653 nonsense probably null
R1393:Ptcd3 UTSW 6 71889621 missense probably benign 0.00
R1498:Ptcd3 UTSW 6 71893495 missense probably damaging 1.00
R1646:Ptcd3 UTSW 6 71898395 missense probably benign 0.26
R1712:Ptcd3 UTSW 6 71908653 nonsense probably null
R2022:Ptcd3 UTSW 6 71885553 missense probably damaging 1.00
R2248:Ptcd3 UTSW 6 71894285 critical splice donor site probably null
R2406:Ptcd3 UTSW 6 71888647 missense probably damaging 1.00
R3418:Ptcd3 UTSW 6 71883486 missense possibly damaging 0.93
R3419:Ptcd3 UTSW 6 71883486 missense possibly damaging 0.93
R4677:Ptcd3 UTSW 6 71893514 missense probably benign 0.17
R4741:Ptcd3 UTSW 6 71902949 missense probably damaging 1.00
R4752:Ptcd3 UTSW 6 71901312 missense probably damaging 0.99
R5441:Ptcd3 UTSW 6 71881521 missense possibly damaging 0.62
R5583:Ptcd3 UTSW 6 71902936 missense probably damaging 1.00
R5681:Ptcd3 UTSW 6 71907659 missense probably damaging 1.00
R6028:Ptcd3 UTSW 6 71898408 missense probably damaging 1.00
R6324:Ptcd3 UTSW 6 71885327 missense probably benign 0.00
R6600:Ptcd3 UTSW 6 71883546 missense probably damaging 1.00
R6783:Ptcd3 UTSW 6 71908643 missense probably benign 0.00
R6810:Ptcd3 UTSW 6 71885532 missense probably damaging 0.99
R6860:Ptcd3 UTSW 6 71897110 splice site probably null
R6993:Ptcd3 UTSW 6 71885315 missense probably damaging 1.00
X0024:Ptcd3 UTSW 6 71901274 missense probably damaging 1.00
X0065:Ptcd3 UTSW 6 71907806 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AGGTTGGCCTGGGCTATATAAG -3'
(R):5'- CACTGTAGGTGTGAACATTTGG -3'

Sequencing Primer
(F):5'- GCAAGCCTCTTCTACATAGTGAG -3'
(R):5'- GCTTGCAAGCAAGCATT -3'
Posted On2018-06-06