Mutagenetix > Incidental Mutation

Incidental Mutation 'R6514:Duoxa1'

520491

Institutional Source

Beutler Lab

Gene Symbol

Duoxa1

Ensembl Gene

ENSMUSG00000027224

Gene Name

dual oxidase maturation factor 1

Synonyms

Nip1

MMRRC Submission

044641-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R6514 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

122134012-122144255 bp(-) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 122135194 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Serine to Proline at position 184 (S184P)

Ref Sequence

ENSEMBL: ENSMUSP00000106167 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000028653] [ENSMUST00000028656] [ENSMUST00000110537] [ENSMUST00000110538] [ENSMUST00000147788] [ENSMUST00000148417] [ENSMUST00000154412]

AlphaFold

Q8VE49

Predicted Effect

probably benign
Transcript: ENSMUST00000028653
AA Change: S229P

PolyPhen 2 Score 0.024 (Sensitivity: 0.95; Specificity: 0.81)

SMART Domains

Protein: ENSMUSP00000028653
Gene: ENSMUSG00000027224
AA Change: S229P

Domain	Start	End	E-Value	Type
Pfam:DuoxA	10	287	7.2e-115	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000028656

SMART Domains

Protein: ENSMUSP00000028656
Gene: ENSMUSG00000027225

Domain	Start	End	E-Value	Type
Pfam:DuoxA	10	286	5.5e-114	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000110537
AA Change: S229P

PolyPhen 2 Score 0.024 (Sensitivity: 0.95; Specificity: 0.81)

SMART Domains

Protein: ENSMUSP00000106166
Gene: ENSMUSG00000027224
AA Change: S229P

Domain	Start	End	E-Value	Type
Pfam:DuoxA	9	290	3.9e-128	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000110538
AA Change: S184P

PolyPhen 2 Score 0.024 (Sensitivity: 0.95; Specificity: 0.81)

SMART Domains

Protein: ENSMUSP00000106167
Gene: ENSMUSG00000027224
AA Change: S184P

Domain	Start	End	E-Value	Type
Pfam:DuoxA	9	70	1.7e-23	PFAM
Pfam:DuoxA	67	245	2.4e-80	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000147788

SMART Domains

Protein: ENSMUSP00000116280
Gene: ENSMUSG00000027224

Domain	Start	End	E-Value	Type
Pfam:DuoxA	9	134	5.9e-57	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000148417

SMART Domains

Protein: ENSMUSP00000116963
Gene: ENSMUSG00000027224

Domain	Start	End	E-Value	Type
Pfam:DuoxA	9	210	1.2e-99	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000154412

SMART Domains

Protein: ENSMUSP00000116911
Gene: ENSMUSG00000027224

Domain	Start	End	E-Value	Type
Pfam:DuoxA	9	100	6.3e-37	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000155561

Meta Mutation Damage Score

0.3761

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.1%
20x: 94.2%

Validation Efficiency

95% (35/37)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Dual oxidases DUOX1 and DUOX2 are NADPH oxidases which are involved in hydrogen peroxide production necessary for thyroid hormonogenesis. They form a heterodimer with specific maturation factors DUOXA1 and DUOXA2, respectively, which is essential for the maturation and function of the DUOX enzyme complexes. This gene encodes the DUOX1 activator or maturation factor DUOXA1. Rat studies identified a bidirectional promoter which controls the transcription of the DUOX1 and DUOXA1 genes. This protein is cotransported to the cell surface when coexpressed with DUOX1 and is retained in the endoplasmic reticulum when expressed without DUOX1 protein. The expression of this gene or the DUOX1 gene is not suppressed by thyroglobulin (Tg), a macromolecular precursor in thyroid hormone synthesis, while the expression of the DUOX2 and DUOXA2 are significantly suppressed by the Tg. This protein is also a p53-regulated neurogenic factor involved in p53 dependent neuronal differentiation. Multiple alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2013]
PHENOTYPE: Mice homozygous for a knock-out allele of Duoxa1 and 2 exhibit severe hypothyrodism with severe postnatal growth, delayed eye opening, enlarged thyroid, enlarged adenohypophysis, respiratory distress and death at weaning when weaned at 21 days. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 35 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4933414I15Rik	G	A	11: 50,833,569 (GRCm39)	A11V	unknown	Het
Add1	T	A	5: 34,763,317 (GRCm39)	H168Q	probably damaging	Het
Apol7b	C	T	15: 77,308,126 (GRCm39)	R123Q	probably benign	Het
Arrdc3	A	G	13: 81,037,309 (GRCm39)	E155G	probably damaging	Het
Capn7	T	G	14: 31,066,511 (GRCm39)	D108E	probably benign	Het
Cdc6	A	G	11: 98,810,118 (GRCm39)	T476A	probably benign	Het
Cntnap5c	A	G	17: 58,637,165 (GRCm39)	E1014G	probably damaging	Het
Crybg1	A	T	10: 43,873,211 (GRCm39)	L1299H	probably damaging	Het
Ech1	A	G	7: 28,525,440 (GRCm39)	H65R	possibly damaging	Het
Egr3	T	C	14: 70,316,366 (GRCm39)	L59P	probably damaging	Het
Eif4enif1	T	A	11: 3,190,996 (GRCm39)	D724E	probably null	Het
Erbb2	A	G	11: 98,310,972 (GRCm39)	D44G	probably benign	Het
Fer1l5	A	G	1: 36,442,697 (GRCm39)	I739V	probably benign	Het
Gfm1	T	C	3: 67,380,879 (GRCm39)	F665L	probably benign	Het
Gm10801	T	A	2: 98,494,214 (GRCm39)	W119R	probably benign	Het
H2-M11	A	T	17: 36,859,839 (GRCm39)	E277D	probably damaging	Het
Ighv1-66	T	C	12: 115,556,740 (GRCm39)	Y114C	possibly damaging	Het
Irf1	C	G	11: 53,662,148 (GRCm39)	L12V	probably damaging	Het
Itpr3	C	T	17: 27,310,344 (GRCm39)	A403V	probably benign	Het
Ly6g	C	T	15: 75,028,581 (GRCm39)	P14S	probably benign	Het
Mfsd13a	T	C	19: 46,363,064 (GRCm39)		probably null	Het
Mme	T	A	3: 63,272,265 (GRCm39)	C621*	probably null	Het
Mmp16	T	C	4: 18,116,123 (GRCm39)	C576R	probably damaging	Het
Ngp	A	T	9: 110,249,017 (GRCm39)	I30F	probably damaging	Het
Or2q1	T	A	6: 42,794,930 (GRCm39)	I175N	probably damaging	Het
Pdcd6ip	G	A	9: 113,518,762 (GRCm39)	T166I	probably benign	Het
Pgd	C	T	4: 149,245,209 (GRCm39)		probably null	Het
Plcb4	T	A	2: 135,796,916 (GRCm39)	H440Q	probably benign	Het
Ppl	A	G	16: 4,905,181 (GRCm39)	S1705P	probably damaging	Het
Ryr1	A	G	7: 28,746,266 (GRCm39)	F3831S	probably damaging	Het
Serpine2	A	C	1: 79,799,287 (GRCm39)		probably null	Het
Skor2	T	A	18: 76,950,389 (GRCm39)	W906R	probably damaging	Het
Tle6	G	A	10: 81,427,810 (GRCm39)	H482Y	probably damaging	Het
Ufl1	T	A	4: 25,262,238 (GRCm39)	D336V	probably damaging	Het
Vav1	T	C	17: 57,634,660 (GRCm39)	F832L	probably damaging	Het

Other mutations in Duoxa1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02021:Duoxa1	APN	2	122,135,127 (GRCm39)	missense	probably benign	0.35
Minima	UTSW	2	122,134,318 (GRCm39)	missense	probably damaging	1.00
nadir	UTSW	2	122,136,861 (GRCm39)	splice site	probably benign
perigee	UTSW	2	122,135,672 (GRCm39)	nonsense	probably null
R0675:Duoxa1	UTSW	2	122,136,861 (GRCm39)	splice site	probably benign
R0755:Duoxa1	UTSW	2	122,135,161 (GRCm39)	missense	probably benign	0.03
R1387:Duoxa1	UTSW	2	122,134,468 (GRCm39)	missense	possibly damaging	0.82
R2906:Duoxa1	UTSW	2	122,135,155 (GRCm39)	missense	probably benign	0.15
R5327:Duoxa1	UTSW	2	122,134,361 (GRCm39)	missense	probably damaging	0.98
R5886:Duoxa1	UTSW	2	122,134,291 (GRCm39)	missense	possibly damaging	0.82
R6841:Duoxa1	UTSW	2	122,134,462 (GRCm39)	missense	probably damaging	1.00
R6845:Duoxa1	UTSW	2	122,135,672 (GRCm39)	nonsense	probably null
R6959:Duoxa1	UTSW	2	122,134,318 (GRCm39)	missense	probably damaging	1.00
R7232:Duoxa1	UTSW	2	122,135,728 (GRCm39)	missense	probably damaging	1.00
R9473:Duoxa1	UTSW	2	122,134,326 (GRCm39)	missense	probably benign
R9717:Duoxa1	UTSW	2	122,135,622 (GRCm39)	missense	probably damaging	1.00
X0017:Duoxa1	UTSW	2	122,135,200 (GRCm39)	missense	probably benign	0.18

Predicted Primers

PCR Primer
(F):5'- GCACTGACATCCTGACCTCTAG -3'
(R):5'- TGGGACATCTTCTGCCTAGGTC -3'

Sequencing Primer
(F):5'- TGACATCCTGACCTCTAGAAACAG -3'
(R):5'- CTGAAGTCCTCTCTAGCAGGTTAG -3'

Posted On

2018-06-06