Incidental Mutation 'R6514:Add1'
ID520505
Institutional Source Beutler Lab
Gene Symbol Add1
Ensembl Gene ENSMUSG00000029106
Gene Nameadducin 1 (alpha)
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.929) question?
Stock #R6514 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location34573664-34632308 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 34605973 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 168 (H168Q)
Ref Sequence ENSEMBL: ENSMUSP00000109979 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001108] [ENSMUST00000052836] [ENSMUST00000114335] [ENSMUST00000114338] [ENSMUST00000114340] [ENSMUST00000146295] [ENSMUST00000147574]
Predicted Effect probably damaging
Transcript: ENSMUST00000001108
AA Change: H168Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000001108
Gene: ENSMUSG00000029106
AA Change: H168Q

DomainStartEndE-ValueType
low complexity region 5 19 N/A INTRINSIC
Aldolase_II 147 329 5.49e-58 SMART
coiled coil region 599 631 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000052836
AA Change: H168Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000052266
Gene: ENSMUSG00000029106
AA Change: H168Q

DomainStartEndE-ValueType
low complexity region 5 19 N/A INTRINSIC
Aldolase_II 147 329 5.49e-58 SMART
coiled coil region 599 631 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000114335
AA Change: H168Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000109974
Gene: ENSMUSG00000029106
AA Change: H168Q

DomainStartEndE-ValueType
low complexity region 5 19 N/A INTRINSIC
Aldolase_II 147 329 5.49e-58 SMART
coiled coil region 597 629 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000114338
AA Change: H168Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000109977
Gene: ENSMUSG00000029106
AA Change: H168Q

DomainStartEndE-ValueType
low complexity region 5 19 N/A INTRINSIC
Aldolase_II 147 329 5.49e-58 SMART
coiled coil region 568 600 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000114340
AA Change: H168Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000109979
Gene: ENSMUSG00000029106
AA Change: H168Q

DomainStartEndE-ValueType
low complexity region 5 19 N/A INTRINSIC
Aldolase_II 147 329 5.49e-58 SMART
coiled coil region 568 600 N/A INTRINSIC
low complexity region 666 685 N/A INTRINSIC
low complexity region 698 719 N/A INTRINSIC
low complexity region 727 733 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145986
Predicted Effect probably benign
Transcript: ENSMUST00000146295
SMART Domains Protein: ENSMUSP00000118539
Gene: ENSMUSG00000029106

DomainStartEndE-ValueType
low complexity region 5 19 N/A INTRINSIC
Blast:Aldolase_II 102 140 1e-19 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000147574
SMART Domains Protein: ENSMUSP00000116075
Gene: ENSMUSG00000029106

DomainStartEndE-ValueType
low complexity region 5 19 N/A INTRINSIC
Blast:Aldolase_II 102 140 1e-19 BLAST
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.2%
Validation Efficiency 95% (35/37)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Adducins are a family of cytoskeleton proteins encoded by three genes (alpha, beta, gamma). Adducin is a heterodimeric protein that consists of related subunits, which are produced from distinct genes but share a similar structure. Alpha- and beta-adducin include a protease-resistant N-terminal region and a protease-sensitive, hydrophilic C-terminal region. Alpha- and gamma-adducins are ubiquitously expressed. In contrast, beta-adducin is expressed at high levels in brain and hematopoietic tissues. Adducin binds with high affinity to Ca(2+)/calmodulin and is a substrate for protein kinases A and C. Alternative splicing results in multiple variants encoding distinct isoforms; however, not all variants have been fully described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Targeted gene deletion leads to reduced growth and compensated hemolytic anemia. RBCs are osmotically fragile, dehydrated, and spherocytic with severe loss of membrane surface area and reduced MCV. ~50% of homozygotes develop lethal hydrocephaly with dilation of the lateral, 3rd, and 4th ventricles. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933414I15Rik G A 11: 50,942,742 A11V unknown Het
Apol7b C T 15: 77,423,926 R123Q probably benign Het
Arrdc3 A G 13: 80,889,190 E155G probably damaging Het
Capn7 T G 14: 31,344,554 D108E probably benign Het
Cdc6 A G 11: 98,919,292 T476A probably benign Het
Cntnap5c A G 17: 58,330,170 E1014G probably damaging Het
Crybg1 A T 10: 43,997,215 L1299H probably damaging Het
Duoxa1 A G 2: 122,304,713 S184P probably benign Het
Ech1 A G 7: 28,826,015 H65R possibly damaging Het
Egr3 T C 14: 70,078,917 L59P probably damaging Het
Eif4enif1 T A 11: 3,240,996 D724E probably null Het
Erbb2 A G 11: 98,420,146 D44G probably benign Het
Fer1l5 A G 1: 36,403,616 I739V probably benign Het
Gfm1 T C 3: 67,473,546 F665L probably benign Het
Gm10801 T A 2: 98,663,869 W119R probably benign Het
H2-M11 A T 17: 36,548,947 E277D probably damaging Het
Ighv1-66 T C 12: 115,593,120 Y114C possibly damaging Het
Irf1 C G 11: 53,771,322 L12V probably damaging Het
Itpr3 C T 17: 27,091,370 A403V probably benign Het
Ly6g C T 15: 75,156,732 P14S probably benign Het
Mfsd13a T C 19: 46,374,625 probably null Het
Mme T A 3: 63,364,844 C621* probably null Het
Mmp16 T C 4: 18,116,123 C576R probably damaging Het
Ngp A T 9: 110,419,949 I30F probably damaging Het
Olfr450 T A 6: 42,817,996 I175N probably damaging Het
Pdcd6ip G A 9: 113,689,694 T166I probably benign Het
Pgd C T 4: 149,160,752 probably null Het
Plcb4 T A 2: 135,954,996 H440Q probably benign Het
Ppl A G 16: 5,087,317 S1705P probably damaging Het
Ryr1 A G 7: 29,046,841 F3831S probably damaging Het
Serpine2 A C 1: 79,821,570 probably null Het
Skor2 T A 18: 76,862,694 W906R probably damaging Het
Tle6 G A 10: 81,591,976 H482Y probably damaging Het
Ufl1 T A 4: 25,262,238 D336V probably damaging Het
Vav1 T C 17: 57,327,660 F832L probably damaging Het
Other mutations in Add1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00781:Add1 APN 5 34613358 missense probably damaging 1.00
IGL01370:Add1 APN 5 34630515 missense probably damaging 1.00
IGL01670:Add1 APN 5 34620063 missense probably damaging 1.00
IGL02965:Add1 APN 5 34620123 missense probably damaging 0.99
IGL03178:Add1 APN 5 34614245 unclassified probably null
R0126:Add1 UTSW 5 34613579 missense probably benign 0.04
R0189:Add1 UTSW 5 34616648 missense probably benign 0.01
R0195:Add1 UTSW 5 34610646 unclassified probably benign
R0318:Add1 UTSW 5 34625340 missense probably damaging 0.99
R0605:Add1 UTSW 5 34614224 missense possibly damaging 0.87
R0624:Add1 UTSW 5 34605853 missense probably damaging 1.00
R1514:Add1 UTSW 5 34610617 missense probably benign 0.03
R1573:Add1 UTSW 5 34601396 missense possibly damaging 0.89
R2512:Add1 UTSW 5 34616686 missense probably benign 0.02
R2965:Add1 UTSW 5 34630714 missense probably benign 0.00
R2966:Add1 UTSW 5 34630714 missense probably benign 0.00
R5646:Add1 UTSW 5 34630680 missense probably benign 0.10
R5993:Add1 UTSW 5 34601533 missense probably damaging 1.00
R6356:Add1 UTSW 5 34619396 missense probably null 1.00
R6536:Add1 UTSW 5 34601436 missense possibly damaging 0.89
R6659:Add1 UTSW 5 34613295 missense possibly damaging 0.94
R7326:Add1 UTSW 5 34619371 missense probably benign 0.32
R7473:Add1 UTSW 5 34619353 missense possibly damaging 0.84
Z1088:Add1 UTSW 5 34613400 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CCAGAGAGAACATTGTCTTTCTGTC -3'
(R):5'- CAACCTGAGCTGGAACAAGG -3'

Sequencing Primer
(F):5'- TTGTCTTTCTGTCATTGAAATTTCTG -3'
(R):5'- GGGTCAGGTAGAAAATGTTGTTATTC -3'
Posted On2018-06-06