Incidental Mutation 'R6538:Fcmr'
ID520508
Institutional Source Beutler Lab
Gene Symbol Fcmr
Ensembl Gene ENSMUSG00000042474
Gene NameFc fragment of IgM receptor
Synonyms1810037B05Rik, FcmuR, Faim3
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6538 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location130865669-130880791 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 130875025 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 125 (Y125C)
Ref Sequence ENSEMBL: ENSMUSP00000048303 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038829]
Predicted Effect possibly damaging
Transcript: ENSMUST00000038829
AA Change: Y125C

PolyPhen 2 Score 0.717 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000048303
Gene: ENSMUSG00000042474
AA Change: Y125C

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
Pfam:V-set 21 122 1.3e-10 PFAM
low complexity region 212 223 N/A INTRINSIC
transmembrane domain 264 283 N/A INTRINSIC
low complexity region 285 311 N/A INTRINSIC
low complexity region 344 363 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126821
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145446
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149355
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Fc receptors specifically bind to the Fc region of immunoglobulins (Igs) to mediate the unique functions of each Ig class. FAIM3 encodes an Fc receptor for IgM (see MIM 147020) (Kubagawa et al., 2009 [PubMed 19858324]; Shima et al., 2010 [PubMed 20042454]).[supplied by OMIM, Jul 2010]
PHENOTYPE: Mice homozygous for knock-out alleles exhibit a slight decrease in B cell numbers reduced sensitivity to Gal-induced liver damage, increased granulocyte production of ROS and increased sensitivity to infection by Listeria monocytogenes. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 28 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A930009A15Rik A G 10: 115,570,199 probably benign Het
Abcd4 T A 12: 84,611,761 M223L probably benign Het
Adat1 T C 8: 111,968,462 I482V probably benign Het
Arfgef2 A G 2: 166,893,621 probably null Het
Atn1 A G 6: 124,746,549 probably benign Het
Cyb561d2 C A 9: 107,540,017 M178I possibly damaging Het
Dnah14 A T 1: 181,584,985 H30L unknown Het
Dnah2 T C 11: 69,437,197 I3367V possibly damaging Het
Gm21731 T C 13: 120,240,932 V88A possibly damaging Het
Gm7298 G T 6: 121,776,173 V870L probably damaging Het
Gm9774 C T 3: 92,429,255 V47M possibly damaging Het
Grin3a T C 4: 49,770,856 S639G probably damaging Het
Hist1h1t A G 13: 23,695,921 E19G probably benign Het
Ighv9-1 T A 12: 114,094,065 T72S possibly damaging Het
Klra2 T A 6: 131,242,990 H76L probably damaging Het
Lamp1 A G 8: 13,171,285 T209A probably benign Het
Lrrc9 T A 12: 72,500,929 Y1294N probably benign Het
Olfr1094 A T 2: 86,829,525 T258S possibly damaging Het
Olfr222 C T 11: 59,571,585 V52I probably benign Het
Peg10 GAT GATCAT 6: 4,756,449 probably benign Het
Pik3ca T C 3: 32,439,704 Y272H probably damaging Het
Spindoc T C 19: 7,382,699 I35V probably benign Het
St6galnac4 A C 2: 32,597,078 M262L possibly damaging Het
Szt2 C T 4: 118,390,477 probably null Het
Trem1 T C 17: 48,237,090 Y48H possibly damaging Het
Trim38 A T 13: 23,785,949 T164S probably damaging Het
Zfp715 A T 7: 43,299,149 H462Q possibly damaging Het
Zfyve16 C T 13: 92,504,516 G1240E probably damaging Het
Other mutations in Fcmr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01638:Fcmr APN 1 130875122 missense probably benign 0.06
IGL01652:Fcmr APN 1 130878507 missense probably benign 0.25
IGL02106:Fcmr APN 1 130875135 missense probably benign
IGL03270:Fcmr APN 1 130876042 missense possibly damaging 0.63
R1635:Fcmr UTSW 1 130876185 splice site probably null
R1651:Fcmr UTSW 1 130878251 missense probably benign
R1728:Fcmr UTSW 1 130875974 missense probably benign
R1728:Fcmr UTSW 1 130878269 missense probably benign 0.00
R1729:Fcmr UTSW 1 130875974 missense probably benign
R1729:Fcmr UTSW 1 130878269 missense probably benign 0.00
R1730:Fcmr UTSW 1 130875974 missense probably benign
R1730:Fcmr UTSW 1 130878269 missense probably benign 0.00
R1739:Fcmr UTSW 1 130875974 missense probably benign
R1739:Fcmr UTSW 1 130878269 missense probably benign 0.00
R1762:Fcmr UTSW 1 130875974 missense probably benign
R1762:Fcmr UTSW 1 130878269 missense probably benign 0.00
R1783:Fcmr UTSW 1 130875974 missense probably benign
R1783:Fcmr UTSW 1 130878269 missense probably benign 0.00
R1784:Fcmr UTSW 1 130875974 missense probably benign
R1784:Fcmr UTSW 1 130878269 missense probably benign 0.00
R1785:Fcmr UTSW 1 130875974 missense probably benign
R1785:Fcmr UTSW 1 130878269 missense probably benign 0.00
R2037:Fcmr UTSW 1 130878333 missense possibly damaging 0.61
R6111:Fcmr UTSW 1 130877829 missense probably damaging 0.96
R6217:Fcmr UTSW 1 130878323 missense probably damaging 0.96
R6712:Fcmr UTSW 1 130877851 missense probably damaging 0.99
R6965:Fcmr UTSW 1 130875987 missense possibly damaging 0.65
X0025:Fcmr UTSW 1 130874267 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATAGGGAGCGCTGGATATGC -3'
(R):5'- AAGTCCCTTCAGCTTTGCTAACTG -3'

Sequencing Primer
(F):5'- TATGCTGGTGGGAAAGGCC -3'
(R):5'- GCTTTGCTAACTGCCTTATGAATTG -3'
Posted On2018-06-06