Incidental Mutation 'R6539:Zfc3h1'
ID520610
Institutional Source Beutler Lab
Gene Symbol Zfc3h1
Ensembl Gene ENSMUSG00000034163
Gene Namezinc finger, C3H1-type containing
SynonymsCcdc131, Psrc2
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.933) question?
Stock #R6539 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location115384959-115432772 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 115412002 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Lysine at position 1037 (E1037K)
Ref Sequence ENSEMBL: ENSMUSP00000044069 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036044]
Predicted Effect probably benign
Transcript: ENSMUST00000036044
AA Change: E1037K

PolyPhen 2 Score 0.260 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000044069
Gene: ENSMUSG00000034163
AA Change: E1037K

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
low complexity region 29 90 N/A INTRINSIC
low complexity region 120 132 N/A INTRINSIC
low complexity region 143 214 N/A INTRINSIC
coiled coil region 361 393 N/A INTRINSIC
low complexity region 399 432 N/A INTRINSIC
coiled coil region 436 491 N/A INTRINSIC
low complexity region 543 556 N/A INTRINSIC
low complexity region 564 583 N/A INTRINSIC
low complexity region 595 619 N/A INTRINSIC
low complexity region 623 636 N/A INTRINSIC
low complexity region 716 729 N/A INTRINSIC
low complexity region 752 763 N/A INTRINSIC
coiled coil region 826 889 N/A INTRINSIC
coiled coil region 968 1000 N/A INTRINSIC
low complexity region 1001 1015 N/A INTRINSIC
Pfam:zf-C3H1 1187 1208 1.3e-11 PFAM
HAT 1384 1416 1.11e0 SMART
HAT 1418 1449 4.35e2 SMART
Blast:HAT 1495 1538 2e-9 BLAST
HAT 1653 1685 3.31e1 SMART
HAT 1762 1797 7.03e1 SMART
HAT 1922 1954 1.29e-1 SMART
low complexity region 1975 1992 N/A INTRINSIC
Meta Mutation Damage Score 0.226 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.3%
Validation Efficiency 100% (46/46)
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810043G02Rik A G 10: 77,984,488 T231A probably benign Het
Adam5 G A 8: 24,782,600 A513V possibly damaging Het
Ano8 T C 8: 71,484,483 D147G probably damaging Het
Apba1 A G 19: 23,936,560 D649G probably damaging Het
Atp6v0d1 T C 8: 105,524,974 I329V probably benign Het
Card6 T A 15: 5,105,391 N110I probably damaging Het
Chn2 T A 6: 54,173,461 probably null Het
Cyp46a1 G A 12: 108,353,157 probably null Het
Daam2 T A 17: 49,469,711 H782L probably damaging Het
Defa26 A G 8: 21,618,246 I22V possibly damaging Het
Dlk1 A G 12: 109,460,319 M278V probably benign Het
Dync2h1 T C 9: 7,159,478 probably null Het
Ehmt1 T A 2: 24,804,767 H1056L probably damaging Het
Ephb3 G A 16: 21,221,468 D527N probably benign Het
Fam46a T C 9: 85,326,561 I70V possibly damaging Het
Flt1 T C 5: 147,578,376 K1079E probably benign Het
Fndc3b C T 3: 27,538,057 G231R probably benign Het
Gm4924 T A 10: 82,378,524 probably benign Het
Ifrd1 G A 12: 40,203,435 A426V probably damaging Het
Ift140 T C 17: 25,094,669 L1358P possibly damaging Het
Igkv5-37 A T 6: 69,963,816 S16T probably benign Het
Map3k9 A G 12: 81,732,192 L449P probably damaging Het
Mdm1 T C 10: 118,150,958 probably null Het
Mmrn1 A T 6: 60,987,184 T1056S probably benign Het
Mroh2b C T 15: 4,905,574 H164Y probably damaging Het
Muc16 T C 9: 18,637,325 T5891A probably benign Het
Nagpa T C 16: 5,203,701 E62G possibly damaging Het
Nek10 T A 14: 14,860,789 V475D possibly damaging Het
Olfr1188 T C 2: 88,559,520 F6S probably damaging Het
Olfr194 A C 16: 59,119,751 S106R probably damaging Het
Pan3 T C 5: 147,450,653 I144T possibly damaging Het
Parvg T A 15: 84,341,340 D349E probably damaging Het
Pitpna A G 11: 75,598,301 Y58C probably damaging Het
Ppp4r3b T A 11: 29,218,503 D73E probably benign Het
Preb A G 5: 30,956,076 V338A probably benign Het
Sec23a T C 12: 58,985,212 T411A probably benign Het
Smc6 A G 12: 11,297,010 probably null Het
Stxbp5l A G 16: 37,129,815 M1056T probably damaging Het
Tbcd T A 11: 121,556,987 probably null Het
Tpx2 G T 2: 152,876,598 E174* probably null Het
Trpc4ap G T 2: 155,636,258 P663T probably benign Het
Unc5cl G A 17: 48,465,017 G441D probably damaging Het
Xrcc2 G T 5: 25,692,532 R140S probably benign Het
Zfhx4 A T 3: 5,244,108 Q798L probably damaging Het
Zfp94 G A 7: 24,303,291 T236M probably damaging Het
Other mutations in Zfc3h1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00698:Zfc3h1 APN 10 115419832 missense possibly damaging 0.92
IGL00793:Zfc3h1 APN 10 115416874 missense probably benign 0.00
IGL01349:Zfc3h1 APN 10 115423448 missense probably damaging 1.00
IGL01431:Zfc3h1 APN 10 115423223 missense possibly damaging 0.49
IGL02273:Zfc3h1 APN 10 115427099 missense probably benign
IGL02382:Zfc3h1 APN 10 115416876 nonsense probably null
IGL02397:Zfc3h1 APN 10 115407985 missense probably damaging 1.00
IGL02657:Zfc3h1 APN 10 115411954 missense possibly damaging 0.48
IGL02826:Zfc3h1 APN 10 115400904 missense probably benign 0.42
gnatcatcher UTSW 10 115400742 missense probably benign 0.39
vireo UTSW 10 115419901 missense probably benign 0.01
warbler UTSW 10 115406483 missense probably damaging 1.00
PIT4260001:Zfc3h1 UTSW 10 115390889 missense probably damaging 0.99
PIT4354001:Zfc3h1 UTSW 10 115427039 nonsense probably null
R0062:Zfc3h1 UTSW 10 115416753 missense probably benign 0.00
R0062:Zfc3h1 UTSW 10 115416753 missense probably benign 0.00
R0067:Zfc3h1 UTSW 10 115423474 missense possibly damaging 0.88
R0067:Zfc3h1 UTSW 10 115423474 missense possibly damaging 0.88
R0104:Zfc3h1 UTSW 10 115415287 missense possibly damaging 0.66
R0178:Zfc3h1 UTSW 10 115406725 splice site probably benign
R0355:Zfc3h1 UTSW 10 115409113 missense possibly damaging 0.80
R0619:Zfc3h1 UTSW 10 115420810 missense possibly damaging 0.92
R0731:Zfc3h1 UTSW 10 115410632 missense probably benign 0.00
R0828:Zfc3h1 UTSW 10 115401707 missense possibly damaging 0.68
R0866:Zfc3h1 UTSW 10 115427716 missense probably benign 0.00
R1196:Zfc3h1 UTSW 10 115411961 missense probably damaging 0.99
R1455:Zfc3h1 UTSW 10 115412108 missense probably benign 0.11
R1515:Zfc3h1 UTSW 10 115416742 missense probably benign 0.29
R1617:Zfc3h1 UTSW 10 115390922 missense probably benign 0.01
R1640:Zfc3h1 UTSW 10 115406901 splice site probably null
R1959:Zfc3h1 UTSW 10 115423253 missense probably benign 0.34
R2039:Zfc3h1 UTSW 10 115406483 missense probably damaging 1.00
R3430:Zfc3h1 UTSW 10 115410523 splice site probably benign
R3691:Zfc3h1 UTSW 10 115420690 missense probably benign
R3909:Zfc3h1 UTSW 10 115419901 missense probably benign 0.01
R4235:Zfc3h1 UTSW 10 115418799 missense probably benign 0.32
R4684:Zfc3h1 UTSW 10 115423385 missense probably benign 0.03
R4816:Zfc3h1 UTSW 10 115415694 missense probably benign 0.16
R4881:Zfc3h1 UTSW 10 115400742 missense probably benign 0.39
R4883:Zfc3h1 UTSW 10 115410642 missense probably damaging 1.00
R5038:Zfc3h1 UTSW 10 115404211 missense probably benign 0.16
R5068:Zfc3h1 UTSW 10 115418783 nonsense probably null
R5069:Zfc3h1 UTSW 10 115418783 nonsense probably null
R5070:Zfc3h1 UTSW 10 115418783 nonsense probably null
R5155:Zfc3h1 UTSW 10 115412121 missense possibly damaging 0.64
R5190:Zfc3h1 UTSW 10 115418692 missense probably damaging 1.00
R5499:Zfc3h1 UTSW 10 115410693 missense probably damaging 1.00
R5932:Zfc3h1 UTSW 10 115400910 missense probably benign 0.44
R5935:Zfc3h1 UTSW 10 115431357 intron probably benign
R6165:Zfc3h1 UTSW 10 115420669 missense probably benign 0.30
R6182:Zfc3h1 UTSW 10 115390859 missense probably benign 0.00
R6262:Zfc3h1 UTSW 10 115413976 missense probably damaging 1.00
R6382:Zfc3h1 UTSW 10 115407908 missense probably benign 0.06
R6392:Zfc3h1 UTSW 10 115401748 missense probably damaging 1.00
R6723:Zfc3h1 UTSW 10 115420733 missense probably benign 0.34
R7339:Zfc3h1 UTSW 10 115403300 missense probably damaging 1.00
R7381:Zfc3h1 UTSW 10 115424630 missense probably benign
R7404:Zfc3h1 UTSW 10 115415248 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- AGTCCAAGGAAGCATTCAGC -3'
(R):5'- CTTACCTGGCCATGCAGAAC -3'

Sequencing Primer
(F):5'- GCATTCAGCAGAATTAATTGCTATGG -3'
(R):5'- TGGCCATGCAGAACTTTTTC -3'
Posted On2018-06-06