Incidental Mutation 'R6541:Ass1'
ID520738
Institutional Source Beutler Lab
Gene Symbol Ass1
Ensembl Gene ENSMUSG00000076441
Gene Nameargininosuccinate synthetase 1
SynonymsAss-1, ASS, fold
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6541 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location31470207-31520672 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 31510233 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 321 (V321A)
Ref Sequence ENSEMBL: ENSMUSP00000099904 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102840]
Predicted Effect probably damaging
Transcript: ENSMUST00000102840
AA Change: V321A

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000099904
Gene: ENSMUSG00000076441
AA Change: V321A

DomainStartEndE-ValueType
Pfam:QueC 6 93 2.8e-7 PFAM
Pfam:Arginosuc_synth 8 403 1.9e-177 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126474
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192802
Meta Mutation Damage Score 0.298 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.8%
Validation Efficiency 97% (36/37)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene catalyzes the penultimate step of the arginine biosynthetic pathway. There are approximately 10 to 14 copies of this gene including the pseudogenes scattered across the human genome, among which the one located on chromosome 9 appears to be the only functional gene for argininosuccinate synthetase. Mutations in the chromosome 9 copy of this gene cause citrullinemia. Two transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Aug 2012]
PHENOTYPE: Targeted disruption of this gene results in high levels of blood citrulline, hyperammonemia, and death by 24 hours after birth. Some spontaneous mutations display wrinkled skin, sparse hair with delayed hair appearance and abnormal hair follicle morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700016D06Rik T A 8: 11,662,613 Q79L probably benign Het
2410089E03Rik T C 15: 8,219,295 V1776A possibly damaging Het
BC028528 T A 3: 95,888,218 M91L probably benign Het
Bicra T C 7: 15,979,129 T998A probably benign Het
Cdkl3 T G 11: 52,022,744 L220R probably damaging Het
Cluh A G 11: 74,657,214 D117G probably damaging Het
Crygf T C 1: 65,928,065 F116S probably damaging Het
Ergic2 T A 6: 148,183,150 Y20F probably damaging Het
Esf1 A G 2: 140,167,879 V179A probably benign Het
Gm28360 T C 1: 117,830,317 probably benign Het
Hhatl C T 9: 121,785,144 V385I probably damaging Het
Iba57 A T 11: 59,158,863 D219E possibly damaging Het
Il1f8 T A 2: 24,159,815 V146D probably damaging Het
Itgal T A 7: 127,311,562 V176E probably damaging Het
Kdm3a T C 6: 71,594,533 M1060V possibly damaging Het
Kif18b T C 11: 102,914,266 K351R probably damaging Het
Mroh9 A G 1: 163,058,038 F342L possibly damaging Het
Ndufa11 T A 17: 56,717,867 S10T probably benign Het
Olfr1152 T C 2: 87,868,294 F101S probably benign Het
Olfr1344 A T 7: 6,440,493 N198Y probably benign Het
Olfr711 A T 7: 106,972,203 F47Y probably benign Het
Olfr871 T A 9: 20,212,399 F17I probably benign Het
Pacsin3 A G 2: 91,262,784 E207G probably damaging Het
Pcsk1 T A 13: 75,125,984 L136Q probably damaging Het
Prr18 G T 17: 8,341,336 R108L possibly damaging Het
Rdh5 A G 10: 128,918,108 V44A possibly damaging Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Sh2d4b T C 14: 40,820,791 T343A probably benign Het
Slc16a10 T C 10: 40,037,272 N480S probably benign Het
Sval3 A T 6: 41,972,446 N73Y probably damaging Het
Taar7d T C 10: 24,028,231 I337T probably benign Het
Ttn T A 2: 76,746,695 Q24618L possibly damaging Het
Ugt1a9 T A 1: 88,071,596 V256E probably damaging Het
Vmn2r108 T A 17: 20,481,218 I7F probably benign Het
Vmn2r55 A G 7: 12,671,012 S155P probably damaging Het
Vwa3b T A 1: 37,051,761 V169E probably damaging Het
Other mutations in Ass1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01413:Ass1 APN 2 31476922 missense probably damaging 1.00
IGL02152:Ass1 APN 2 31492324 missense probably damaging 1.00
R0008:Ass1 UTSW 2 31514819 missense probably damaging 1.00
R0083:Ass1 UTSW 2 31514819 missense probably damaging 1.00
R0084:Ass1 UTSW 2 31514819 missense probably damaging 1.00
R0085:Ass1 UTSW 2 31514819 missense probably damaging 1.00
R0087:Ass1 UTSW 2 31514819 missense probably damaging 1.00
R0183:Ass1 UTSW 2 31514819 missense probably damaging 1.00
R0220:Ass1 UTSW 2 31514819 missense probably damaging 1.00
R0254:Ass1 UTSW 2 31514819 missense probably damaging 1.00
R0302:Ass1 UTSW 2 31514819 missense probably damaging 1.00
R0346:Ass1 UTSW 2 31514819 missense probably damaging 1.00
R0440:Ass1 UTSW 2 31514819 missense probably damaging 1.00
R0472:Ass1 UTSW 2 31514819 missense probably damaging 1.00
R0605:Ass1 UTSW 2 31514819 missense probably damaging 1.00
R0644:Ass1 UTSW 2 31514819 missense probably damaging 1.00
R1460:Ass1 UTSW 2 31514741 missense probably benign 0.37
R1465:Ass1 UTSW 2 31520416 makesense probably null
R1465:Ass1 UTSW 2 31520416 makesense probably null
R1770:Ass1 UTSW 2 31486516 missense probably benign 0.29
R1908:Ass1 UTSW 2 31493148 nonsense probably null
R2361:Ass1 UTSW 2 31520382 missense probably benign 0.02
R2430:Ass1 UTSW 2 31501496 missense probably damaging 1.00
R3816:Ass1 UTSW 2 31510105 splice site probably benign
R4614:Ass1 UTSW 2 31514783 missense probably damaging 1.00
R4628:Ass1 UTSW 2 31480988 missense probably damaging 1.00
R5007:Ass1 UTSW 2 31501532 missense possibly damaging 0.90
R5069:Ass1 UTSW 2 31510173 missense probably damaging 1.00
R5081:Ass1 UTSW 2 31488653 critical splice donor site probably null
R5315:Ass1 UTSW 2 31492329 missense probably benign 0.21
R5370:Ass1 UTSW 2 31518733 missense possibly damaging 0.56
R6259:Ass1 UTSW 2 31488642 missense possibly damaging 0.80
R6731:Ass1 UTSW 2 31514784 missense probably damaging 1.00
R6927:Ass1 UTSW 2 31514801 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGCTTGTCTCCTGTCAGAC -3'
(R):5'- TCCAACCTTCCATGTGTACTTGAG -3'

Sequencing Primer
(F):5'- CATTTGCTGACAGTTTGGGTTTCATG -3'
(R):5'- AACCTTCCATGTGTACTTGAGAGTTC -3'
Posted On2018-06-06