Incidental Mutation 'R6517:Tnks1bp1'
ID520779
Institutional Source Beutler Lab
Gene Symbol Tnks1bp1
Ensembl Gene ENSMUSG00000033955
Gene Nametankyrase 1 binding protein 1
SynonymsTAB182
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6517 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location85048022-85073048 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 85059345 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 672 (V672A)
Ref Sequence ENSEMBL: ENSMUSP00000107232 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048400] [ENSMUST00000111605]
Predicted Effect probably benign
Transcript: ENSMUST00000048400
AA Change: V10A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000045767
Gene: ENSMUSG00000033955
AA Change: V10A

DomainStartEndE-ValueType
low complexity region 77 96 N/A INTRINSIC
low complexity region 292 298 N/A INTRINSIC
low complexity region 809 827 N/A INTRINSIC
low complexity region 868 875 N/A INTRINSIC
Tankyrase_bdg_C 883 1055 1.98e-79 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000111605
AA Change: V672A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000107232
Gene: ENSMUSG00000033955
AA Change: V672A

DomainStartEndE-ValueType
low complexity region 37 44 N/A INTRINSIC
low complexity region 59 72 N/A INTRINSIC
low complexity region 296 316 N/A INTRINSIC
low complexity region 380 391 N/A INTRINSIC
low complexity region 496 518 N/A INTRINSIC
low complexity region 739 758 N/A INTRINSIC
low complexity region 954 960 N/A INTRINSIC
low complexity region 1471 1489 N/A INTRINSIC
low complexity region 1530 1537 N/A INTRINSIC
Tankyrase_bdg_C 1545 1717 1.98e-79 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126309
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148682
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151092
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actr8 C T 14: 29,982,716 Q58* probably null Het
Adamts20 A C 15: 94,283,104 probably null Het
Alpk3 T A 7: 81,078,579 S486T possibly damaging Het
Cep162 T A 9: 87,222,174 E553V probably damaging Het
Epha5 T C 5: 84,156,501 I370V possibly damaging Het
Ets1 A T 9: 32,752,797 probably null Het
Fbxo38 C T 18: 62,533,563 E180K probably damaging Het
Fscn1 A G 5: 142,971,986 D296G probably damaging Het
Glul A G 1: 153,908,033 I325V probably benign Het
Keg1 A G 19: 12,715,910 D99G probably benign Het
Krt1 A T 15: 101,850,267 V154D possibly damaging Het
Mdfic T A 6: 15,770,325 I110N probably damaging Het
Myo1g T C 11: 6,512,509 N541D probably damaging Het
Nos3 T A 5: 24,383,624 V1116D probably damaging Het
Olfr1098 A G 2: 86,923,097 I145T probably benign Het
Piwil2 G T 14: 70,374,336 Q954K probably benign Het
Ppm1l T C 3: 69,317,583 M6T probably damaging Het
Scn3a T A 2: 65,497,563 E861V possibly damaging Het
Senp2 C T 16: 22,026,724 T236M possibly damaging Het
Sgo2b A T 8: 63,931,494 V156D probably damaging Het
Sis T C 3: 72,907,142 Y1585C probably damaging Het
Slc22a22 A G 15: 57,250,969 S321P probably benign Het
Slu7 T A 11: 43,438,148 Y66N probably damaging Het
Stra6l A G 4: 45,879,473 H365R probably benign Het
Stt3b T C 9: 115,267,342 T246A probably benign Het
Taf1c T G 8: 119,604,247 N44T possibly damaging Het
Tcirg1 C T 19: 3,901,933 V376M probably damaging Het
Tkt A G 14: 30,549,323 D17G probably damaging Het
Tle6 G A 10: 81,591,976 H482Y probably damaging Het
Zdbf2 T G 1: 63,305,520 D1019E possibly damaging Het
Zfp608 A T 18: 54,899,078 C597S possibly damaging Het
Zfp986 G C 4: 145,899,300 D177H probably benign Het
Other mutations in Tnks1bp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00870:Tnks1bp1 APN 2 85062236 nonsense probably null
IGL00974:Tnks1bp1 APN 2 85062882 missense possibly damaging 0.92
IGL01874:Tnks1bp1 APN 2 85058447 missense probably benign 0.01
IGL02419:Tnks1bp1 APN 2 85071781 missense possibly damaging 0.60
IGL02441:Tnks1bp1 APN 2 85071799 missense probably damaging 1.00
IGL02475:Tnks1bp1 APN 2 85059377 missense probably damaging 1.00
IGL03181:Tnks1bp1 APN 2 85062714 missense probably benign 0.00
K3955:Tnks1bp1 UTSW 2 85062411 missense probably benign 0.01
P0038:Tnks1bp1 UTSW 2 85062411 missense probably benign 0.01
PIT4791001:Tnks1bp1 UTSW 2 85062558 missense probably benign 0.03
R0068:Tnks1bp1 UTSW 2 85062352 missense probably benign 0.12
R0068:Tnks1bp1 UTSW 2 85062352 missense probably benign 0.12
R0164:Tnks1bp1 UTSW 2 85059221 missense possibly damaging 0.94
R0164:Tnks1bp1 UTSW 2 85059221 missense possibly damaging 0.94
R0189:Tnks1bp1 UTSW 2 85070929 missense possibly damaging 0.77
R0454:Tnks1bp1 UTSW 2 85072137 missense probably damaging 1.00
R0650:Tnks1bp1 UTSW 2 85062630 missense possibly damaging 0.68
R0737:Tnks1bp1 UTSW 2 85052536 missense possibly damaging 0.93
R1718:Tnks1bp1 UTSW 2 85071738 missense probably benign 0.44
R1749:Tnks1bp1 UTSW 2 85063067 missense probably benign
R2194:Tnks1bp1 UTSW 2 85063065 missense probably benign 0.06
R2314:Tnks1bp1 UTSW 2 85058915 missense probably benign 0.01
R2379:Tnks1bp1 UTSW 2 85063838 missense probably benign 0.16
R3056:Tnks1bp1 UTSW 2 85070000 nonsense probably null
R3433:Tnks1bp1 UTSW 2 85071016 splice site probably benign
R3751:Tnks1bp1 UTSW 2 85058722 start gained probably benign
R4502:Tnks1bp1 UTSW 2 85062647 nonsense probably null
R4694:Tnks1bp1 UTSW 2 85071722 missense probably damaging 1.00
R4785:Tnks1bp1 UTSW 2 85063034 missense probably damaging 1.00
R5079:Tnks1bp1 UTSW 2 85062626 missense probably damaging 1.00
R5208:Tnks1bp1 UTSW 2 85070632 missense probably damaging 0.96
R5265:Tnks1bp1 UTSW 2 85062754 missense probably benign 0.01
R5512:Tnks1bp1 UTSW 2 85062834 missense probably benign 0.00
R5557:Tnks1bp1 UTSW 2 85063800 missense probably damaging 0.97
R6016:Tnks1bp1 UTSW 2 85052390 missense probably damaging 1.00
R6177:Tnks1bp1 UTSW 2 85059280 start gained probably benign
R6516:Tnks1bp1 UTSW 2 85070727 missense probably damaging 0.97
R7032:Tnks1bp1 UTSW 2 85061953 missense probably benign 0.00
R7120:Tnks1bp1 UTSW 2 85072097 missense probably damaging 1.00
R7302:Tnks1bp1 UTSW 2 85052354 missense probably benign 0.24
Predicted Primers PCR Primer
(F):5'- CCCATTACTTTGGCTGCAAGG -3'
(R):5'- GTTAAAAGAATGAAGCCCACCTG -3'

Sequencing Primer
(F):5'- GCCTTACCTGTGCTAGAGC -3'
(R):5'- GCACCCTACCCCTGATGC -3'
Posted On2018-06-06