Incidental Mutation 'R6517:Olfr1098'
ID520781
Institutional Source Beutler Lab
Gene Symbol Olfr1098
Ensembl Gene ENSMUSG00000075169
Gene Nameolfactory receptor 1098
SynonymsMOR206-1, GA_x6K02T2Q125-48410458-48409511
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.039) question?
Stock #R6517 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location86920949-86924545 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 86923097 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 145 (I145T)
Ref Sequence ENSEMBL: ENSMUSP00000107200 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099872] [ENSMUST00000111574]
Predicted Effect probably benign
Transcript: ENSMUST00000099872
AA Change: I145T

PolyPhen 2 Score 0.053 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000097457
Gene: ENSMUSG00000075169
AA Change: I145T

DomainStartEndE-ValueType
Pfam:7tm_1 41 290 7e-29 PFAM
Pfam:7tm_4 140 283 3.3e-41 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000111574
AA Change: I145T

PolyPhen 2 Score 0.053 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000107200
Gene: ENSMUSG00000075169
AA Change: I145T

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 1.8e-52 PFAM
Pfam:7tm_1 41 309 8.1e-20 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.8%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actr8 C T 14: 29,982,716 Q58* probably null Het
Adamts20 A C 15: 94,283,104 probably null Het
Alpk3 T A 7: 81,078,579 S486T possibly damaging Het
Cep162 T A 9: 87,222,174 E553V probably damaging Het
Epha5 T C 5: 84,156,501 I370V possibly damaging Het
Ets1 A T 9: 32,752,797 probably null Het
Fbxo38 C T 18: 62,533,563 E180K probably damaging Het
Fscn1 A G 5: 142,971,986 D296G probably damaging Het
Glul A G 1: 153,908,033 I325V probably benign Het
Keg1 A G 19: 12,715,910 D99G probably benign Het
Krt1 A T 15: 101,850,267 V154D possibly damaging Het
Mdfic T A 6: 15,770,325 I110N probably damaging Het
Myo1g T C 11: 6,512,509 N541D probably damaging Het
Nos3 T A 5: 24,383,624 V1116D probably damaging Het
Piwil2 G T 14: 70,374,336 Q954K probably benign Het
Ppm1l T C 3: 69,317,583 M6T probably damaging Het
Scn3a T A 2: 65,497,563 E861V possibly damaging Het
Senp2 C T 16: 22,026,724 T236M possibly damaging Het
Sgo2b A T 8: 63,931,494 V156D probably damaging Het
Sis T C 3: 72,907,142 Y1585C probably damaging Het
Slc22a22 A G 15: 57,250,969 S321P probably benign Het
Slu7 T A 11: 43,438,148 Y66N probably damaging Het
Stra6l A G 4: 45,879,473 H365R probably benign Het
Stt3b T C 9: 115,267,342 T246A probably benign Het
Taf1c T G 8: 119,604,247 N44T possibly damaging Het
Tcirg1 C T 19: 3,901,933 V376M probably damaging Het
Tkt A G 14: 30,549,323 D17G probably damaging Het
Tle6 G A 10: 81,591,976 H482Y probably damaging Het
Tnks1bp1 T C 2: 85,059,345 V672A probably benign Het
Zdbf2 T G 1: 63,305,520 D1019E possibly damaging Het
Zfp608 A T 18: 54,899,078 C597S possibly damaging Het
Zfp986 G C 4: 145,899,300 D177H probably benign Het
Other mutations in Olfr1098
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01318:Olfr1098 APN 2 86922949 missense probably benign
IGL02547:Olfr1098 APN 2 86923028 missense probably damaging 1.00
IGL02881:Olfr1098 APN 2 86922713 missense possibly damaging 0.94
IGL03073:Olfr1098 APN 2 86923353 missense probably damaging 1.00
R0117:Olfr1098 UTSW 2 86922870 missense probably damaging 1.00
R0808:Olfr1098 UTSW 2 86923451 missense probably damaging 1.00
R1061:Olfr1098 UTSW 2 86922782 missense possibly damaging 0.93
R1471:Olfr1098 UTSW 2 86922578 unclassified probably null
R1571:Olfr1098 UTSW 2 86923445 missense probably benign 0.01
R1680:Olfr1098 UTSW 2 86923161 missense probably benign 0.10
R2341:Olfr1098 UTSW 2 86922638 missense possibly damaging 0.63
R2368:Olfr1098 UTSW 2 86923107 missense probably benign
R3158:Olfr1098 UTSW 2 86922606 missense probably benign
R3425:Olfr1098 UTSW 2 86922606 missense probably benign
R3499:Olfr1098 UTSW 2 86923029 missense possibly damaging 0.94
R4156:Olfr1098 UTSW 2 86922878 missense probably damaging 1.00
R4526:Olfr1098 UTSW 2 86922995 missense possibly damaging 0.90
R5743:Olfr1098 UTSW 2 86923205 missense probably benign 0.01
R5942:Olfr1098 UTSW 2 86923406 missense probably damaging 1.00
R6372:Olfr1098 UTSW 2 86923155 missense probably damaging 1.00
R6409:Olfr1098 UTSW 2 86923171 nonsense probably null
R6661:Olfr1098 UTSW 2 86923148 missense probably benign 0.02
R7075:Olfr1098 UTSW 2 86922646 missense possibly damaging 0.88
R7166:Olfr1098 UTSW 2 86922748 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- CGGATATCGTGATTAGCGACAG -3'
(R):5'- TTACAGAATACGCTGACCTCC -3'

Sequencing Primer
(F):5'- TGGAACCAGCTAAAACGAATATTGTG -3'
(R):5'- TCGTCAATGGCCTATGAC -3'
Posted On2018-06-06