Incidental Mutation 'R6541:Rnd2'
ID 520784
Institutional Source Beutler Lab
Gene Symbol Rnd2
Ensembl Gene ENSMUSG00000001313
Gene Name Rho family GTPase 2
Synonyms Rohn, Arhn
MMRRC Submission 044667-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R6541 (G1)
Quality Score 225.009
Status Validated
Chromosome 11
Chromosomal Location 101359001-101362679 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 101359825 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Phenylalanine at position 57 (L57F)
Ref Sequence ENSEMBL: ENSMUSP00000001347 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001347] [ENSMUST00000040430]
AlphaFold Q9QYM5
Predicted Effect probably damaging
Transcript: ENSMUST00000001347
AA Change: L57F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000001347
Gene: ENSMUSG00000001313
AA Change: L57F

DomainStartEndE-ValueType
RHO 10 184 5.22e-100 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000040430
SMART Domains Protein: ENSMUSP00000048350
Gene: ENSMUSG00000034993

DomainStartEndE-ValueType
low complexity region 3 31 N/A INTRINSIC
low complexity region 41 60 N/A INTRINSIC
Pfam:ADH_N 89 157 8.8e-11 PFAM
Pfam:ADH_zinc_N 213 355 2.1e-21 PFAM
Pfam:ADH_zinc_N_2 245 398 6.9e-22 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134980
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153185
Meta Mutation Damage Score 0.1630 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.8%
Validation Efficiency 97% (36/37)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Rho GTPase family, whose members play a key role in the regulation of actin cytoskeleton organization in response to extracellular growth factors. This particular family member has been implicated in the regulation of neuronal morphology and endosomal trafficking. The gene localizes to chromosome 17 and is the centromeric neighbor of the breast-ovarian cancer susceptibility gene BRCA1. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ass1 T C 2: 31,400,245 (GRCm39) V321A probably damaging Het
BC028528 T A 3: 95,795,530 (GRCm39) M91L probably benign Het
Bicra T C 7: 15,713,054 (GRCm39) T998A probably benign Het
Cdkl3 T G 11: 51,913,571 (GRCm39) L220R probably damaging Het
Cluh A G 11: 74,548,040 (GRCm39) D117G probably damaging Het
Cplane1 T C 15: 8,248,779 (GRCm39) V1776A possibly damaging Het
Crygf T C 1: 65,967,224 (GRCm39) F116S probably damaging Het
Ergic2 T A 6: 148,084,648 (GRCm39) Y20F probably damaging Het
Esf1 A G 2: 140,009,799 (GRCm39) V179A probably benign Het
Gm28360 T C 1: 117,758,047 (GRCm39) probably benign Het
Hhatl C T 9: 121,614,210 (GRCm39) V385I probably damaging Het
Iba57 A T 11: 59,049,689 (GRCm39) D219E possibly damaging Het
Il36b T A 2: 24,049,827 (GRCm39) V146D probably damaging Het
Itgal T A 7: 126,910,734 (GRCm39) V176E probably damaging Het
Kdm3a T C 6: 71,571,517 (GRCm39) M1060V possibly damaging Het
Kif18b T C 11: 102,805,092 (GRCm39) K351R probably damaging Het
Mroh9 A G 1: 162,885,607 (GRCm39) F342L possibly damaging Het
Ndufa11 T A 17: 57,024,867 (GRCm39) S10T probably benign Het
Or2bd2 A T 7: 6,443,492 (GRCm39) N198Y probably benign Het
Or5w19 T C 2: 87,698,638 (GRCm39) F101S probably benign Het
Or6b6 A T 7: 106,571,410 (GRCm39) F47Y probably benign Het
Or7h8 T A 9: 20,123,695 (GRCm39) F17I probably benign Het
Pacsin3 A G 2: 91,093,129 (GRCm39) E207G probably damaging Het
Pcsk1 T A 13: 75,274,103 (GRCm39) L136Q probably damaging Het
Prr18 G T 17: 8,560,168 (GRCm39) R108L possibly damaging Het
Rdh5 A G 10: 128,753,977 (GRCm39) V44A possibly damaging Het
Sh2d4b T C 14: 40,542,748 (GRCm39) T343A probably benign Het
Slc16a10 T C 10: 39,913,268 (GRCm39) N480S probably benign Het
Spaca7b T A 8: 11,712,613 (GRCm39) Q79L probably benign Het
Sval3 A T 6: 41,949,380 (GRCm39) N73Y probably damaging Het
Taar7d T C 10: 23,904,129 (GRCm39) I337T probably benign Het
Ttn T A 2: 76,577,039 (GRCm39) Q24618L possibly damaging Het
Ugt1a9 T A 1: 87,999,318 (GRCm39) V256E probably damaging Het
Vmn2r108 T A 17: 20,701,480 (GRCm39) I7F probably benign Het
Vmn2r55 A G 7: 12,404,939 (GRCm39) S155P probably damaging Het
Vwa3b T A 1: 37,090,842 (GRCm39) V169E probably damaging Het
Other mutations in Rnd2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00596:Rnd2 APN 11 101,362,017 (GRCm39) missense possibly damaging 0.81
IGL01964:Rnd2 APN 11 101,361,632 (GRCm39) splice site probably null
Atkins UTSW 11 101,359,825 (GRCm39) missense probably damaging 1.00
R1581:Rnd2 UTSW 11 101,362,022 (GRCm39) missense probably benign
R4606:Rnd2 UTSW 11 101,359,825 (GRCm39) missense probably damaging 1.00
R4797:Rnd2 UTSW 11 101,359,825 (GRCm39) missense probably damaging 1.00
R4824:Rnd2 UTSW 11 101,359,825 (GRCm39) missense probably damaging 1.00
R4825:Rnd2 UTSW 11 101,359,825 (GRCm39) missense probably damaging 1.00
R4931:Rnd2 UTSW 11 101,359,825 (GRCm39) missense probably damaging 1.00
R5005:Rnd2 UTSW 11 101,359,825 (GRCm39) missense probably damaging 1.00
R5078:Rnd2 UTSW 11 101,359,825 (GRCm39) missense probably damaging 1.00
R5079:Rnd2 UTSW 11 101,359,825 (GRCm39) missense probably damaging 1.00
R5402:Rnd2 UTSW 11 101,359,825 (GRCm39) missense probably damaging 1.00
R5405:Rnd2 UTSW 11 101,359,825 (GRCm39) missense probably damaging 1.00
R5497:Rnd2 UTSW 11 101,359,825 (GRCm39) missense probably damaging 1.00
R5498:Rnd2 UTSW 11 101,359,825 (GRCm39) missense probably damaging 1.00
R5501:Rnd2 UTSW 11 101,359,825 (GRCm39) missense probably damaging 1.00
R5534:Rnd2 UTSW 11 101,359,825 (GRCm39) missense probably damaging 1.00
R5619:Rnd2 UTSW 11 101,359,825 (GRCm39) missense probably damaging 1.00
R5666:Rnd2 UTSW 11 101,359,825 (GRCm39) missense probably damaging 1.00
R5669:Rnd2 UTSW 11 101,359,825 (GRCm39) missense probably damaging 1.00
R5670:Rnd2 UTSW 11 101,359,825 (GRCm39) missense probably damaging 1.00
R5671:Rnd2 UTSW 11 101,359,825 (GRCm39) missense probably damaging 1.00
R5786:Rnd2 UTSW 11 101,359,825 (GRCm39) missense probably damaging 1.00
R5788:Rnd2 UTSW 11 101,359,825 (GRCm39) missense probably damaging 1.00
R5844:Rnd2 UTSW 11 101,359,825 (GRCm39) missense probably damaging 1.00
R5845:Rnd2 UTSW 11 101,359,825 (GRCm39) missense probably damaging 1.00
R5857:Rnd2 UTSW 11 101,359,825 (GRCm39) missense probably damaging 1.00
R5989:Rnd2 UTSW 11 101,359,825 (GRCm39) missense probably damaging 1.00
R5991:Rnd2 UTSW 11 101,359,825 (GRCm39) missense probably damaging 1.00
R5992:Rnd2 UTSW 11 101,359,825 (GRCm39) missense probably damaging 1.00
R6018:Rnd2 UTSW 11 101,359,825 (GRCm39) missense probably damaging 1.00
R6019:Rnd2 UTSW 11 101,359,825 (GRCm39) missense probably damaging 1.00
R6020:Rnd2 UTSW 11 101,359,825 (GRCm39) missense probably damaging 1.00
R6122:Rnd2 UTSW 11 101,359,825 (GRCm39) missense probably damaging 1.00
R6144:Rnd2 UTSW 11 101,359,825 (GRCm39) missense probably damaging 1.00
R6148:Rnd2 UTSW 11 101,359,825 (GRCm39) missense probably damaging 1.00
R6208:Rnd2 UTSW 11 101,359,825 (GRCm39) missense probably damaging 1.00
R6209:Rnd2 UTSW 11 101,359,825 (GRCm39) missense probably damaging 1.00
R6226:Rnd2 UTSW 11 101,359,825 (GRCm39) missense probably damaging 1.00
R6230:Rnd2 UTSW 11 101,359,825 (GRCm39) missense probably damaging 1.00
R6332:Rnd2 UTSW 11 101,359,825 (GRCm39) missense probably damaging 1.00
R6333:Rnd2 UTSW 11 101,359,825 (GRCm39) missense probably damaging 1.00
R6335:Rnd2 UTSW 11 101,359,825 (GRCm39) missense probably damaging 1.00
R6491:Rnd2 UTSW 11 101,359,825 (GRCm39) missense probably damaging 1.00
R6605:Rnd2 UTSW 11 101,359,825 (GRCm39) missense probably damaging 1.00
R6606:Rnd2 UTSW 11 101,359,825 (GRCm39) missense probably damaging 1.00
R6607:Rnd2 UTSW 11 101,359,825 (GRCm39) missense probably damaging 1.00
R6677:Rnd2 UTSW 11 101,359,825 (GRCm39) missense probably damaging 1.00
R6678:Rnd2 UTSW 11 101,359,825 (GRCm39) missense probably damaging 1.00
R6726:Rnd2 UTSW 11 101,359,825 (GRCm39) missense probably damaging 1.00
R6796:Rnd2 UTSW 11 101,359,825 (GRCm39) missense probably damaging 1.00
R6797:Rnd2 UTSW 11 101,359,825 (GRCm39) missense probably damaging 1.00
R8415:Rnd2 UTSW 11 101,362,011 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- CAGCCTCAGACCAACTTCTG -3'
(R):5'- CCTACGTGGTTTCTGTCAGG -3'

Sequencing Primer
(F):5'- ACCAACTTCTGTCTAGGGACTGAG -3'
(R):5'- GGTTTCTGTCAGGCCTAAGAAACTC -3'
Posted On 2018-06-06