Incidental Mutation 'R6517:Zfp986'
ID520789
Institutional Source Beutler Lab
Gene Symbol Zfp986
Ensembl Gene ENSMUSG00000078500
Gene Namezinc finger protein 986
SynonymsGm13235
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.186) question?
Stock #R6517 (G1)
Quality Score149.008
Status Not validated
Chromosome4
Chromosomal Location145868794-145899975 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to C at 145899300 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Histidine at position 177 (D177H)
Ref Sequence ENSEMBL: ENSMUSP00000116281 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000123460] [ENSMUST00000166629]
Predicted Effect probably benign
Transcript: ENSMUST00000123460
AA Change: D177H

PolyPhen 2 Score 0.296 (Sensitivity: 0.91; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000116281
Gene: ENSMUSG00000078500
AA Change: D177H

DomainStartEndE-ValueType
KRAB 13 76 4.74e-16 SMART
ZnF_C2H2 240 262 2.61e-4 SMART
ZnF_C2H2 268 290 9.73e-4 SMART
ZnF_C2H2 296 318 7.78e-3 SMART
ZnF_C2H2 324 346 7.49e-5 SMART
ZnF_C2H2 352 374 2.79e-4 SMART
ZnF_C2H2 380 400 1.41e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000166629
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actr8 C T 14: 29,982,716 Q58* probably null Het
Adamts20 A C 15: 94,283,104 probably null Het
Alpk3 T A 7: 81,078,579 S486T possibly damaging Het
Cep162 T A 9: 87,222,174 E553V probably damaging Het
Epha5 T C 5: 84,156,501 I370V possibly damaging Het
Ets1 A T 9: 32,752,797 probably null Het
Fbxo38 C T 18: 62,533,563 E180K probably damaging Het
Fscn1 A G 5: 142,971,986 D296G probably damaging Het
Glul A G 1: 153,908,033 I325V probably benign Het
Keg1 A G 19: 12,715,910 D99G probably benign Het
Krt1 A T 15: 101,850,267 V154D possibly damaging Het
Mdfic T A 6: 15,770,325 I110N probably damaging Het
Myo1g T C 11: 6,512,509 N541D probably damaging Het
Nos3 T A 5: 24,383,624 V1116D probably damaging Het
Olfr1098 A G 2: 86,923,097 I145T probably benign Het
Piwil2 G T 14: 70,374,336 Q954K probably benign Het
Ppm1l T C 3: 69,317,583 M6T probably damaging Het
Scn3a T A 2: 65,497,563 E861V possibly damaging Het
Senp2 C T 16: 22,026,724 T236M possibly damaging Het
Sgo2b A T 8: 63,931,494 V156D probably damaging Het
Sis T C 3: 72,907,142 Y1585C probably damaging Het
Slc22a22 A G 15: 57,250,969 S321P probably benign Het
Slu7 T A 11: 43,438,148 Y66N probably damaging Het
Stra6l A G 4: 45,879,473 H365R probably benign Het
Stt3b T C 9: 115,267,342 T246A probably benign Het
Taf1c T G 8: 119,604,247 N44T possibly damaging Het
Tcirg1 C T 19: 3,901,933 V376M probably damaging Het
Tkt A G 14: 30,549,323 D17G probably damaging Het
Tle6 G A 10: 81,591,976 H482Y probably damaging Het
Tnks1bp1 T C 2: 85,059,345 V672A probably benign Het
Zdbf2 T G 1: 63,305,520 D1019E possibly damaging Het
Zfp608 A T 18: 54,899,078 C597S possibly damaging Het
Other mutations in Zfp986
AlleleSourceChrCoordTypePredicted EffectPPH Score
FR4548:Zfp986 UTSW 4 145899358 missense probably benign 0.01
PIT4142001:Zfp986 UTSW 4 145898943 missense probably benign
R0126:Zfp986 UTSW 4 145898943 missense probably benign
R1835:Zfp986 UTSW 4 145899235 missense probably benign 0.00
R3926:Zfp986 UTSW 4 145892520 splice site probably benign
R4287:Zfp986 UTSW 4 145892518 critical splice donor site probably null
R4401:Zfp986 UTSW 4 145898943 missense probably benign
Predicted Primers PCR Primer
(F):5'- GATGCTCTTCAATTCTCGAACC -3'
(R):5'- GGTAAAGCATTTGTCACATTCACTG -3'

Sequencing Primer
(F):5'- AAAAAGACTTAAGCCCAGGAACAC -3'
(R):5'- GTCACATTCACTGCATTTGTAAGG -3'
Posted On2018-06-06