Incidental Mutation 'R6517:Fscn1'
ID520795
Institutional Source Beutler Lab
Gene Symbol Fscn1
Ensembl Gene ENSMUSG00000029581
Gene Namefascin actin-bundling protein 1
SynonymsFan1, fascin-1
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.533) question?
Stock #R6517 (G1)
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location142960343-142973185 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 142971986 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 296 (D296G)
Ref Sequence ENSEMBL: ENSMUSP00000142509 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031565] [ENSMUST00000198017]
Predicted Effect probably damaging
Transcript: ENSMUST00000031565
AA Change: D457G

PolyPhen 2 Score 0.960 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000031565
Gene: ENSMUSG00000029581
AA Change: D457G

DomainStartEndE-ValueType
Pfam:Fascin 20 134 1.9e-37 PFAM
Pfam:Fascin 142 256 4.1e-30 PFAM
Pfam:Fascin 268 378 1.3e-36 PFAM
Pfam:Fascin 391 493 9.4e-24 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000129306
AA Change: D204G
SMART Domains Protein: ENSMUSP00000122862
Gene: ENSMUSG00000029581
AA Change: D204G

DomainStartEndE-ValueType
Pfam:Fascin 16 126 1.1e-37 PFAM
Pfam:Fascin 139 241 8.3e-25 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135293
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137552
SMART Domains Protein: ENSMUSP00000119590
Gene: ENSMUSG00000029581

DomainStartEndE-ValueType
Pfam:Fascin 1 100 1.6e-33 PFAM
Pfam:Fascin 113 167 1.1e-14 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139131
SMART Domains Protein: ENSMUSP00000115116
Gene: ENSMUSG00000029581

DomainStartEndE-ValueType
Pfam:Fascin 1 100 1.1e-33 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150622
SMART Domains Protein: ENSMUSP00000123347
Gene: ENSMUSG00000029581

DomainStartEndE-ValueType
Pfam:Fascin 1 100 3.4e-34 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000198017
AA Change: D296G

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000142509
Gene: ENSMUSG00000029581
AA Change: D296G

DomainStartEndE-ValueType
Pfam:Fascin 20 74 2.3e-12 PFAM
Pfam:Fascin 107 217 7.3e-34 PFAM
Pfam:Fascin 230 332 1.5e-23 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the fascin family of actin-binding proteins. Fascin proteins organize F-actin into parallel bundles, and are required for the formation of actin-based cellular protrusions. The encoded protein plays a critical role in cell migration, motility, adhesion and cellular interactions. Expression of this gene is known to be regulated by several microRNAs, and overexpression of this gene may play a role in the metastasis of multiple types of cancer by increasing cell motility. Expression of this gene is also a marker for Reed-Sternberg cells in Hodgkin's lymphoma. A pseudogene of this gene is located on the long arm of chromosome 15. [provided by RefSeq, Sep 2011]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit impaired migration of mature dendritic cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actr8 C T 14: 29,982,716 Q58* probably null Het
Adamts20 A C 15: 94,283,104 probably null Het
Alpk3 T A 7: 81,078,579 S486T possibly damaging Het
Cep162 T A 9: 87,222,174 E553V probably damaging Het
Epha5 T C 5: 84,156,501 I370V possibly damaging Het
Ets1 A T 9: 32,752,797 probably null Het
Fbxo38 C T 18: 62,533,563 E180K probably damaging Het
Glul A G 1: 153,908,033 I325V probably benign Het
Keg1 A G 19: 12,715,910 D99G probably benign Het
Krt1 A T 15: 101,850,267 V154D possibly damaging Het
Mdfic T A 6: 15,770,325 I110N probably damaging Het
Myo1g T C 11: 6,512,509 N541D probably damaging Het
Nos3 T A 5: 24,383,624 V1116D probably damaging Het
Olfr1098 A G 2: 86,923,097 I145T probably benign Het
Piwil2 G T 14: 70,374,336 Q954K probably benign Het
Ppm1l T C 3: 69,317,583 M6T probably damaging Het
Scn3a T A 2: 65,497,563 E861V possibly damaging Het
Senp2 C T 16: 22,026,724 T236M possibly damaging Het
Sgo2b A T 8: 63,931,494 V156D probably damaging Het
Sis T C 3: 72,907,142 Y1585C probably damaging Het
Slc22a22 A G 15: 57,250,969 S321P probably benign Het
Slu7 T A 11: 43,438,148 Y66N probably damaging Het
Stra6l A G 4: 45,879,473 H365R probably benign Het
Stt3b T C 9: 115,267,342 T246A probably benign Het
Taf1c T G 8: 119,604,247 N44T possibly damaging Het
Tcirg1 C T 19: 3,901,933 V376M probably damaging Het
Tkt A G 14: 30,549,323 D17G probably damaging Het
Tle6 G A 10: 81,591,976 H482Y probably damaging Het
Tnks1bp1 T C 2: 85,059,345 V672A probably benign Het
Zdbf2 T G 1: 63,305,520 D1019E possibly damaging Het
Zfp608 A T 18: 54,899,078 C597S possibly damaging Het
Zfp986 G C 4: 145,899,300 D177H probably benign Het
Other mutations in Fscn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02189:Fscn1 APN 5 142960620 missense possibly damaging 0.46
IGL02311:Fscn1 APN 5 142972010 missense probably benign 0.08
R0037:Fscn1 UTSW 5 142970694 splice site probably benign
R1163:Fscn1 UTSW 5 142960843 missense probably damaging 1.00
R1860:Fscn1 UTSW 5 142970063 critical splice donor site probably null
R4342:Fscn1 UTSW 5 142972021 missense probably damaging 1.00
R5569:Fscn1 UTSW 5 142961044 missense probably benign 0.13
R6248:Fscn1 UTSW 5 142961023 missense possibly damaging 0.94
R6594:Fscn1 UTSW 5 142970028 missense probably benign 0.02
R6964:Fscn1 UTSW 5 142960660 missense probably damaging 1.00
R7000:Fscn1 UTSW 5 142960627 missense probably damaging 1.00
R7108:Fscn1 UTSW 5 142960515 missense probably damaging 1.00
R7165:Fscn1 UTSW 5 142972046 missense probably benign 0.13
R7233:Fscn1 UTSW 5 142970274 missense possibly damaging 0.83
Predicted Primers PCR Primer
(F):5'- CCACTCAGTTCTGGAAGCTG -3'
(R):5'- GGGTTTCCAGTTTGAAAGGC -3'

Sequencing Primer
(F):5'- ACTCAGTTCTGGAAGCTGACAGC -3'
(R):5'- TTTCCAGTTTGAAAGGCAAGGG -3'
Posted On2018-06-06