Mutagenetix > Incidental Mutation

Incidental Mutation 'R6517:Sgo2b'

520800

Institutional Source

Beutler Lab

Gene Symbol

Sgo2b

Ensembl Gene

ENSMUSG00000094443

Gene Name

shugoshin 2B

Synonyms

Gm4975, Sgol2b

MMRRC Submission

044644-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.073) question?

Stock #

R6517 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

64377728-64405204 bp(-) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 64384528 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Valine to Aspartic acid at position 156 (V156D)

Ref Sequence

ENSEMBL: ENSMUSP00000136323 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000179944]

AlphaFold

J3QMK1

Predicted Effect

probably damaging
Transcript: ENSMUST00000179944
AA Change: V156D

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000136323
Gene: ENSMUSG00000094443
AA Change: V156D

Domain	Start	End	E-Value	Type
coiled coil region	54	113	N/A	INTRINSIC
low complexity region	122	135	N/A	INTRINSIC
low complexity region	163	172	N/A	INTRINSIC
low complexity region	400	414	N/A	INTRINSIC
internal_repeat_1	528	618	9.12e-8	PROSPERO
internal_repeat_1	713	809	9.12e-8	PROSPERO
low complexity region	1009	1024	N/A	INTRINSIC
low complexity region	1059	1081	N/A	INTRINSIC
low complexity region	1112	1126	N/A	INTRINSIC
low complexity region	1130	1148	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000210516

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000210915

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 97.9%
20x: 93.8%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 32 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Actr8	C	T	14: 29,704,673 (GRCm39)	Q58*	probably null	Het
Adamts20	A	C	15: 94,180,985 (GRCm39)		probably null	Het
Alpk3	T	A	7: 80,728,327 (GRCm39)	S486T	possibly damaging	Het
Cep162	T	A	9: 87,104,227 (GRCm39)	E553V	probably damaging	Het
Epha5	T	C	5: 84,304,360 (GRCm39)	I370V	possibly damaging	Het
Ets1	A	T	9: 32,664,093 (GRCm39)		probably null	Het
Fbxo38	C	T	18: 62,666,634 (GRCm39)	E180K	probably damaging	Het
Fscn1	A	G	5: 142,957,741 (GRCm39)	D296G	probably damaging	Het
Glul	A	G	1: 153,783,779 (GRCm39)	I325V	probably benign	Het
Keg1	A	G	19: 12,693,274 (GRCm39)	D99G	probably benign	Het
Krt1	A	T	15: 101,758,702 (GRCm39)	V154D	possibly damaging	Het
Mdfic	T	A	6: 15,770,324 (GRCm39)	I110N	probably damaging	Het
Myo1g	T	C	11: 6,462,509 (GRCm39)	N541D	probably damaging	Het
Nos3	T	A	5: 24,588,622 (GRCm39)	V1116D	probably damaging	Het
Or8h8	A	G	2: 86,753,441 (GRCm39)	I145T	probably benign	Het
Piwil2	G	T	14: 70,611,785 (GRCm39)	Q954K	probably benign	Het
Ppm1l	T	C	3: 69,224,916 (GRCm39)	M6T	probably damaging	Het
Scn3a	T	A	2: 65,327,907 (GRCm39)	E861V	possibly damaging	Het
Senp2	C	T	16: 21,845,474 (GRCm39)	T236M	possibly damaging	Het
Sis	T	C	3: 72,814,475 (GRCm39)	Y1585C	probably damaging	Het
Slc22a22	A	G	15: 57,114,365 (GRCm39)	S321P	probably benign	Het
Slu7	T	A	11: 43,328,975 (GRCm39)	Y66N	probably damaging	Het
Stra6l	A	G	4: 45,879,473 (GRCm39)	H365R	probably benign	Het
Stt3b	T	C	9: 115,096,410 (GRCm39)	T246A	probably benign	Het
Taf1c	T	G	8: 120,330,986 (GRCm39)	N44T	possibly damaging	Het
Tcirg1	C	T	19: 3,951,933 (GRCm39)	V376M	probably damaging	Het
Tkt	A	G	14: 30,271,280 (GRCm39)	D17G	probably damaging	Het
Tle6	G	A	10: 81,427,810 (GRCm39)	H482Y	probably damaging	Het
Tnks1bp1	T	C	2: 84,889,689 (GRCm39)	V672A	probably benign	Het
Zdbf2	T	G	1: 63,344,679 (GRCm39)	D1019E	possibly damaging	Het
Zfp608	A	T	18: 55,032,150 (GRCm39)	C597S	possibly damaging	Het
Zfp986	G	C	4: 145,625,870 (GRCm39)	D177H	probably benign	Het

Other mutations in Sgo2b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01017:Sgo2b	APN	8	64,379,557 (GRCm39)	missense	probably benign
IGL01343:Sgo2b	APN	8	64,380,349 (GRCm39)	nonsense	probably null
IGL02027:Sgo2b	APN	8	64,379,863 (GRCm39)	missense	probably benign
IGL02090:Sgo2b	APN	8	64,380,123 (GRCm39)	missense	probably damaging	0.99
IGL02121:Sgo2b	APN	8	64,384,316 (GRCm39)	missense	possibly damaging	0.94
IGL02206:Sgo2b	APN	8	64,394,118 (GRCm39)	missense	possibly damaging	0.94
IGL02554:Sgo2b	APN	8	64,379,571 (GRCm39)	missense	probably damaging	0.96
IGL02663:Sgo2b	APN	8	64,396,148 (GRCm39)	missense	probably damaging	0.97
IGL03149:Sgo2b	APN	8	64,379,617 (GRCm39)	missense	probably benign	0.14
floater	UTSW	8	64,391,451 (GRCm39)	nonsense	probably null
R0164:Sgo2b	UTSW	8	64,391,417 (GRCm39)	missense	possibly damaging	0.92
R0164:Sgo2b	UTSW	8	64,391,417 (GRCm39)	missense	possibly damaging	0.92
R0201:Sgo2b	UTSW	8	64,379,670 (GRCm39)	missense	probably benign
R0285:Sgo2b	UTSW	8	64,381,823 (GRCm39)	nonsense	probably null
R0325:Sgo2b	UTSW	8	64,381,410 (GRCm39)	missense	probably benign	0.20
R0727:Sgo2b	UTSW	8	64,380,816 (GRCm39)	missense	probably damaging	0.98
R0943:Sgo2b	UTSW	8	64,384,369 (GRCm39)	missense	possibly damaging	0.82
R1148:Sgo2b	UTSW	8	64,379,889 (GRCm39)	missense	probably damaging	0.99
R1266:Sgo2b	UTSW	8	64,381,455 (GRCm39)	missense	probably benign	0.00
R1484:Sgo2b	UTSW	8	64,384,507 (GRCm39)	missense	possibly damaging	0.77
R1493:Sgo2b	UTSW	8	64,379,889 (GRCm39)	missense	probably damaging	0.99
R1537:Sgo2b	UTSW	8	64,379,536 (GRCm39)	missense	possibly damaging	0.94
R1630:Sgo2b	UTSW	8	64,380,831 (GRCm39)	missense	possibly damaging	0.90
R1803:Sgo2b	UTSW	8	64,380,426 (GRCm39)	missense	probably benign	0.01
R1912:Sgo2b	UTSW	8	64,384,503 (GRCm39)	missense	probably damaging	0.98
R1993:Sgo2b	UTSW	8	64,379,867 (GRCm39)	missense	probably benign	0.36
R2042:Sgo2b	UTSW	8	64,381,561 (GRCm39)	missense	probably benign
R2130:Sgo2b	UTSW	8	64,380,181 (GRCm39)	missense	probably benign	0.09
R2146:Sgo2b	UTSW	8	64,381,057 (GRCm39)	missense	probably benign	0.00
R2881:Sgo2b	UTSW	8	64,380,570 (GRCm39)	missense	probably damaging	0.99
R3686:Sgo2b	UTSW	8	64,384,361 (GRCm39)	missense	probably benign	0.20
R3706:Sgo2b	UTSW	8	64,381,179 (GRCm39)	missense	probably damaging	0.98
R3889:Sgo2b	UTSW	8	64,380,777 (GRCm39)	missense	possibly damaging	0.82
R3894:Sgo2b	UTSW	8	64,381,767 (GRCm39)	missense	possibly damaging	0.91
R3895:Sgo2b	UTSW	8	64,381,767 (GRCm39)	missense	possibly damaging	0.91
R4058:Sgo2b	UTSW	8	64,379,981 (GRCm39)	missense	probably damaging	0.98
R4259:Sgo2b	UTSW	8	64,381,330 (GRCm39)	missense	probably benign	0.06
R4260:Sgo2b	UTSW	8	64,381,330 (GRCm39)	missense	probably benign	0.06
R4704:Sgo2b	UTSW	8	64,380,824 (GRCm39)	missense	probably damaging	0.98
R4815:Sgo2b	UTSW	8	64,384,448 (GRCm39)	missense	probably benign
R4922:Sgo2b	UTSW	8	64,379,664 (GRCm39)	missense	possibly damaging	0.66
R5232:Sgo2b	UTSW	8	64,381,636 (GRCm39)	missense	possibly damaging	0.55
R5262:Sgo2b	UTSW	8	64,396,171 (GRCm39)	missense	probably damaging	0.99
R5444:Sgo2b	UTSW	8	64,379,590 (GRCm39)	missense	possibly damaging	0.90
R5677:Sgo2b	UTSW	8	64,380,008 (GRCm39)	missense	possibly damaging	0.77
R5959:Sgo2b	UTSW	8	64,380,322 (GRCm39)	missense	probably benign	0.01
R6004:Sgo2b	UTSW	8	64,379,707 (GRCm39)	nonsense	probably null
R6267:Sgo2b	UTSW	8	64,380,827 (GRCm39)	missense	probably benign
R6296:Sgo2b	UTSW	8	64,380,827 (GRCm39)	missense	probably benign
R6328:Sgo2b	UTSW	8	64,381,345 (GRCm39)	nonsense	probably null
R6523:Sgo2b	UTSW	8	64,380,538 (GRCm39)	missense	probably benign	0.11
R6726:Sgo2b	UTSW	8	64,380,769 (GRCm39)	nonsense	probably null
R6957:Sgo2b	UTSW	8	64,384,489 (GRCm39)	small deletion	probably benign
R7031:Sgo2b	UTSW	8	64,393,078 (GRCm39)	missense	possibly damaging	0.94
R7034:Sgo2b	UTSW	8	64,379,868 (GRCm39)	missense	probably benign	0.36
R7145:Sgo2b	UTSW	8	64,381,218 (GRCm39)	missense	probably damaging	1.00
R7289:Sgo2b	UTSW	8	64,394,192 (GRCm39)	missense	probably damaging	0.97
R7366:Sgo2b	UTSW	8	64,391,451 (GRCm39)	nonsense	probably null
R7660:Sgo2b	UTSW	8	64,393,108 (GRCm39)	missense	probably benign	0.27
R7761:Sgo2b	UTSW	8	64,379,946 (GRCm39)	missense	probably benign
R7762:Sgo2b	UTSW	8	64,379,531 (GRCm39)	missense	probably benign	0.03
R7822:Sgo2b	UTSW	8	64,380,318 (GRCm39)	missense	probably damaging	0.98
R8111:Sgo2b	UTSW	8	64,396,138 (GRCm39)	missense	probably damaging	0.98
R8129:Sgo2b	UTSW	8	64,381,834 (GRCm39)	missense	possibly damaging	0.90
R8273:Sgo2b	UTSW	8	64,377,735 (GRCm39)	missense	unknown
R8856:Sgo2b	UTSW	8	64,393,091 (GRCm39)	missense	probably null	0.99
R9249:Sgo2b	UTSW	8	64,391,407 (GRCm39)	nonsense	probably null
R9428:Sgo2b	UTSW	8	64,393,067 (GRCm39)	missense	probably damaging	0.99
R9616:Sgo2b	UTSW	8	64,380,274 (GRCm39)	missense	probably benign
R9621:Sgo2b	UTSW	8	64,380,651 (GRCm39)	missense	probably damaging	0.99
RF014:Sgo2b	UTSW	8	64,384,439 (GRCm39)	missense	possibly damaging	0.94
RF055:Sgo2b	UTSW	8	64,396,203 (GRCm39)	missense	probably damaging	1.00
Z1088:Sgo2b	UTSW	8	64,381,456 (GRCm39)	missense	possibly damaging	0.61
Z1088:Sgo2b	UTSW	8	64,380,039 (GRCm39)	missense	probably damaging	1.00
Z1177:Sgo2b	UTSW	8	64,381,419 (GRCm39)	missense	possibly damaging	0.82
Z1177:Sgo2b	UTSW	8	64,380,473 (GRCm39)	missense	probably benign	0.03

Predicted Primers

PCR Primer
(F):5'- GAACCACATGTTTTCTGATTACCT -3'
(R):5'- TCCTTCTCTGCATCACAAAATTATTA -3'

Sequencing Primer
(F):5'- GAAGTAGTATCAGGTGAGGTC -3'
(R):5'- ACATGCTCATAGCTGCTAGG -3'

Posted On

2018-06-06