Incidental Mutation 'R6517:Taf1c'
ID520802
Institutional Source Beutler Lab
Gene Symbol Taf1c
Ensembl Gene ENSMUSG00000031832
Gene NameTATA-box binding protein associated factor, RNA polymerase I, C
SynonymsmTAFI95
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.904) question?
Stock #R6517 (G1)
Quality Score225.009
Status Not validated
Chromosome8
Chromosomal Location119597871-119605222 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 119604247 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Threonine at position 44 (N44T)
Ref Sequence ENSEMBL: ENSMUSP00000118480 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093099] [ENSMUST00000147964]
Predicted Effect probably benign
Transcript: ENSMUST00000093099
AA Change: N44T

PolyPhen 2 Score 0.133 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000090789
Gene: ENSMUSG00000031832
AA Change: N44T

DomainStartEndE-ValueType
low complexity region 60 79 N/A INTRINSIC
SCOP:d1k32a3 253 389 2e-3 SMART
Blast:WD40 301 340 2e-15 BLAST
low complexity region 457 472 N/A INTRINSIC
low complexity region 478 490 N/A INTRINSIC
low complexity region 520 535 N/A INTRINSIC
low complexity region 724 732 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000117927
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126547
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131652
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144379
Predicted Effect possibly damaging
Transcript: ENSMUST00000147964
AA Change: N44T

PolyPhen 2 Score 0.588 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000118480
Gene: ENSMUSG00000031832
AA Change: N44T

DomainStartEndE-ValueType
low complexity region 60 79 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212929
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Initiation of transcription by RNA polymerase I requires the formation of a complex composed of the TATA-binding protein (TBP) and three TBP-associated factors (TAFs) specific for RNA polymerase I. This complex, known as SL1, binds to the core promoter of ribosomal RNA genes to position the polymerase properly and acts as a channel for regulatory signals. This gene encodes the largest SL1-specific TAF. Multiple alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2011]
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actr8 C T 14: 29,982,716 Q58* probably null Het
Adamts20 A C 15: 94,283,104 probably null Het
Alpk3 T A 7: 81,078,579 S486T possibly damaging Het
Cep162 T A 9: 87,222,174 E553V probably damaging Het
Epha5 T C 5: 84,156,501 I370V possibly damaging Het
Ets1 A T 9: 32,752,797 probably null Het
Fbxo38 C T 18: 62,533,563 E180K probably damaging Het
Fscn1 A G 5: 142,971,986 D296G probably damaging Het
Glul A G 1: 153,908,033 I325V probably benign Het
Keg1 A G 19: 12,715,910 D99G probably benign Het
Krt1 A T 15: 101,850,267 V154D possibly damaging Het
Mdfic T A 6: 15,770,325 I110N probably damaging Het
Myo1g T C 11: 6,512,509 N541D probably damaging Het
Nos3 T A 5: 24,383,624 V1116D probably damaging Het
Olfr1098 A G 2: 86,923,097 I145T probably benign Het
Piwil2 G T 14: 70,374,336 Q954K probably benign Het
Ppm1l T C 3: 69,317,583 M6T probably damaging Het
Scn3a T A 2: 65,497,563 E861V possibly damaging Het
Senp2 C T 16: 22,026,724 T236M possibly damaging Het
Sgo2b A T 8: 63,931,494 V156D probably damaging Het
Sis T C 3: 72,907,142 Y1585C probably damaging Het
Slc22a22 A G 15: 57,250,969 S321P probably benign Het
Slu7 T A 11: 43,438,148 Y66N probably damaging Het
Stra6l A G 4: 45,879,473 H365R probably benign Het
Stt3b T C 9: 115,267,342 T246A probably benign Het
Tcirg1 C T 19: 3,901,933 V376M probably damaging Het
Tkt A G 14: 30,549,323 D17G probably damaging Het
Tle6 G A 10: 81,591,976 H482Y probably damaging Het
Tnks1bp1 T C 2: 85,059,345 V672A probably benign Het
Zdbf2 T G 1: 63,305,520 D1019E possibly damaging Het
Zfp608 A T 18: 54,899,078 C597S possibly damaging Het
Zfp986 G C 4: 145,899,300 D177H probably benign Het
Other mutations in Taf1c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00539:Taf1c APN 8 119601328 missense possibly damaging 0.80
IGL01098:Taf1c APN 8 119602841 missense probably damaging 0.98
IGL01287:Taf1c APN 8 119601192 missense probably benign 0.01
IGL02339:Taf1c APN 8 119604280 missense probably damaging 1.00
IGL02642:Taf1c APN 8 119599057 missense probably benign
IGL02954:Taf1c APN 8 119600486 missense probably damaging 1.00
R0026:Taf1c UTSW 8 119604236 splice site probably null
R0031:Taf1c UTSW 8 119599090 missense probably benign 0.00
R0087:Taf1c UTSW 8 119600987 missense probably damaging 1.00
R0197:Taf1c UTSW 8 119599983 missense probably damaging 0.98
R0701:Taf1c UTSW 8 119599983 missense probably damaging 0.98
R0883:Taf1c UTSW 8 119599983 missense probably damaging 0.98
R2200:Taf1c UTSW 8 119598678 missense probably benign
R3726:Taf1c UTSW 8 119603070 missense probably damaging 1.00
R3765:Taf1c UTSW 8 119600485 nonsense probably null
R3916:Taf1c UTSW 8 119600505 missense probably damaging 1.00
R4368:Taf1c UTSW 8 119599316 missense possibly damaging 0.60
R4470:Taf1c UTSW 8 119599622 missense probably benign
R4501:Taf1c UTSW 8 119599429 missense probably damaging 1.00
R4661:Taf1c UTSW 8 119598850 missense probably damaging 0.99
R4741:Taf1c UTSW 8 119603395 unclassified probably benign
R4938:Taf1c UTSW 8 119598798 missense probably benign 0.26
R5481:Taf1c UTSW 8 119599240 missense probably damaging 1.00
R6335:Taf1c UTSW 8 119601779 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGTTGCCTGACTTCCTCATG -3'
(R):5'- TGAGACTCCTAATGAAGGCGTG -3'

Sequencing Primer
(F):5'- GACTTCCTCATGCTGGGC -3'
(R):5'- CTCCTAATGAAGGCGTGTGTAAC -3'
Posted On2018-06-06