Incidental Mutation 'R6517:Ets1'
ID520804
Institutional Source Beutler Lab
Gene Symbol Ets1
Ensembl Gene ENSMUSG00000032035
Gene NameE26 avian leukemia oncogene 1, 5' domain
SynonymsTpl1, Ets-1, p51Ets-1, p42Ets-1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.907) question?
Stock #R6517 (G1)
Quality Score175.009
Status Not validated
Chromosome9
Chromosomal Location32636221-32757820 bp(+) (GRCm38)
Type of Mutationcritical splice acceptor site
DNA Base Change (assembly) A to T at 32752797 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000139107 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034534] [ENSMUST00000050797] [ENSMUST00000184364] [ENSMUST00000184887]
Predicted Effect probably null
Transcript: ENSMUST00000034534
SMART Domains Protein: ENSMUSP00000034534
Gene: ENSMUSG00000032035

DomainStartEndE-ValueType
SAM_PNT 53 136 2.56e-48 SMART
low complexity region 266 278 N/A INTRINSIC
ETS 334 419 1.98e-57 SMART
Predicted Effect probably null
Transcript: ENSMUST00000050797
SMART Domains Protein: ENSMUSP00000051303
Gene: ENSMUSG00000032035

DomainStartEndE-ValueType
SAM_PNT 53 136 2.56e-48 SMART
ETS 247 332 1.98e-57 SMART
Predicted Effect probably null
Transcript: ENSMUST00000184364
SMART Domains Protein: ENSMUSP00000139107
Gene: ENSMUSG00000032035

DomainStartEndE-ValueType
low complexity region 50 62 N/A INTRINSIC
ETS 118 203 1.98e-57 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000184887
SMART Domains Protein: ENSMUSP00000138951
Gene: ENSMUSG00000032035

DomainStartEndE-ValueType
SAM_PNT 53 136 2.56e-48 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the ETS family of transcription factors, which are defined by the presence of a conserved ETS DNA-binding domain that recognizes the core consensus DNA sequence GGAA/T in target genes. These proteins function either as transcriptional activators or repressors of numerous genes, and are involved in stem cell development, cell senescence and death, and tumorigenesis. Alternatively spliced transcript variants encoding different isoforms have been described for this gene.[provided by RefSeq, Jul 2011]
PHENOTYPE: Homozygotes for targeted null mutations exhibit reduced numbers of peripheral CD8+ T cells, impaired TCR-mediated activation of both CD4+ and CD8+ T cells, increased numbers of IgM-secreting plasma cells, and severely impaired NK cell development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actr8 C T 14: 29,982,716 Q58* probably null Het
Adamts20 A C 15: 94,283,104 probably null Het
Alpk3 T A 7: 81,078,579 S486T possibly damaging Het
Cep162 T A 9: 87,222,174 E553V probably damaging Het
Epha5 T C 5: 84,156,501 I370V possibly damaging Het
Fbxo38 C T 18: 62,533,563 E180K probably damaging Het
Fscn1 A G 5: 142,971,986 D296G probably damaging Het
Glul A G 1: 153,908,033 I325V probably benign Het
Keg1 A G 19: 12,715,910 D99G probably benign Het
Krt1 A T 15: 101,850,267 V154D possibly damaging Het
Mdfic T A 6: 15,770,325 I110N probably damaging Het
Myo1g T C 11: 6,512,509 N541D probably damaging Het
Nos3 T A 5: 24,383,624 V1116D probably damaging Het
Olfr1098 A G 2: 86,923,097 I145T probably benign Het
Piwil2 G T 14: 70,374,336 Q954K probably benign Het
Ppm1l T C 3: 69,317,583 M6T probably damaging Het
Scn3a T A 2: 65,497,563 E861V possibly damaging Het
Senp2 C T 16: 22,026,724 T236M possibly damaging Het
Sgo2b A T 8: 63,931,494 V156D probably damaging Het
Sis T C 3: 72,907,142 Y1585C probably damaging Het
Slc22a22 A G 15: 57,250,969 S321P probably benign Het
Slu7 T A 11: 43,438,148 Y66N probably damaging Het
Stra6l A G 4: 45,879,473 H365R probably benign Het
Stt3b T C 9: 115,267,342 T246A probably benign Het
Taf1c T G 8: 119,604,247 N44T possibly damaging Het
Tcirg1 C T 19: 3,901,933 V376M probably damaging Het
Tkt A G 14: 30,549,323 D17G probably damaging Het
Tle6 G A 10: 81,591,976 H482Y probably damaging Het
Tnks1bp1 T C 2: 85,059,345 V672A probably benign Het
Zdbf2 T G 1: 63,305,520 D1019E possibly damaging Het
Zfp608 A T 18: 54,899,078 C597S possibly damaging Het
Zfp986 G C 4: 145,899,300 D177H probably benign Het
Other mutations in Ets1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00733:Ets1 APN 9 32752926 intron probably benign
IGL00899:Ets1 APN 9 32752808 missense probably damaging 1.00
IGL01615:Ets1 APN 9 32732939 splice site probably benign
IGL01867:Ets1 APN 9 32734159 missense probably damaging 0.99
IGL02424:Ets1 APN 9 32754293 nonsense probably null
IGL03204:Ets1 APN 9 32733012 missense possibly damaging 0.64
Ecru UTSW 9 32733960 nonsense probably null
R0479:Ets1 UTSW 9 32730180 missense probably damaging 1.00
R0659:Ets1 UTSW 9 32738293 missense probably damaging 1.00
R0839:Ets1 UTSW 9 32734061 nonsense probably null
R5009:Ets1 UTSW 9 32732999 missense possibly damaging 0.85
R5590:Ets1 UTSW 9 32728798 splice site probably benign
R6367:Ets1 UTSW 9 32733960 nonsense probably null
R6423:Ets1 UTSW 9 32738315 missense probably damaging 0.97
R6584:Ets1 UTSW 9 32733997 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACATGGTGTATCATCCTGTGTG -3'
(R):5'- GGATCACAATCCCAGCATTTTC -3'

Sequencing Primer
(F):5'- GGAAGGGAAATCTTTACTTTCTCTG -3'
(R):5'- GATCACAATCCCAGCATTTTCTCTCG -3'
Posted On2018-06-06