Incidental Mutation 'R6517:Stt3b'
ID520808
Institutional Source Beutler Lab
Gene Symbol Stt3b
Ensembl Gene ENSMUSG00000032437
Gene NameSTT3, subunit of the oligosaccharyltransferase complex, homolog B (S. cerevisiae)
Synonyms1300006C19Rik, Simp
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.615) question?
Stock #R6517 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location115242581-115310421 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 115267342 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 246 (T246A)
Ref Sequence ENSEMBL: ENSMUSP00000035010 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035010]
Predicted Effect probably benign
Transcript: ENSMUST00000035010
AA Change: T246A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000035010
Gene: ENSMUSG00000032437
AA Change: T246A

DomainStartEndE-ValueType
low complexity region 40 60 N/A INTRINSIC
Pfam:STT3 68 560 2e-151 PFAM
low complexity region 807 821 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a catalytic subunit of a protein complex that transfers oligosaccharides onto asparagine residues. Defects in this gene are a cause of congenital disorder of glycosylation Ix (CDG1X). [provided by RefSeq, Jun 2014]
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actr8 C T 14: 29,982,716 Q58* probably null Het
Adamts20 A C 15: 94,283,104 probably null Het
Alpk3 T A 7: 81,078,579 S486T possibly damaging Het
Cep162 T A 9: 87,222,174 E553V probably damaging Het
Epha5 T C 5: 84,156,501 I370V possibly damaging Het
Ets1 A T 9: 32,752,797 probably null Het
Fbxo38 C T 18: 62,533,563 E180K probably damaging Het
Fscn1 A G 5: 142,971,986 D296G probably damaging Het
Glul A G 1: 153,908,033 I325V probably benign Het
Keg1 A G 19: 12,715,910 D99G probably benign Het
Krt1 A T 15: 101,850,267 V154D possibly damaging Het
Mdfic T A 6: 15,770,325 I110N probably damaging Het
Myo1g T C 11: 6,512,509 N541D probably damaging Het
Nos3 T A 5: 24,383,624 V1116D probably damaging Het
Olfr1098 A G 2: 86,923,097 I145T probably benign Het
Piwil2 G T 14: 70,374,336 Q954K probably benign Het
Ppm1l T C 3: 69,317,583 M6T probably damaging Het
Scn3a T A 2: 65,497,563 E861V possibly damaging Het
Senp2 C T 16: 22,026,724 T236M possibly damaging Het
Sgo2b A T 8: 63,931,494 V156D probably damaging Het
Sis T C 3: 72,907,142 Y1585C probably damaging Het
Slc22a22 A G 15: 57,250,969 S321P probably benign Het
Slu7 T A 11: 43,438,148 Y66N probably damaging Het
Stra6l A G 4: 45,879,473 H365R probably benign Het
Taf1c T G 8: 119,604,247 N44T possibly damaging Het
Tcirg1 C T 19: 3,901,933 V376M probably damaging Het
Tkt A G 14: 30,549,323 D17G probably damaging Het
Tle6 G A 10: 81,591,976 H482Y probably damaging Het
Tnks1bp1 T C 2: 85,059,345 V672A probably benign Het
Zdbf2 T G 1: 63,305,520 D1019E possibly damaging Het
Zfp608 A T 18: 54,899,078 C597S possibly damaging Het
Zfp986 G C 4: 145,899,300 D177H probably benign Het
Other mutations in Stt3b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00481:Stt3b APN 9 115251847 missense probably benign 0.42
IGL00929:Stt3b APN 9 115266165 missense probably damaging 1.00
IGL01333:Stt3b APN 9 115257544 missense probably damaging 0.97
IGL01389:Stt3b APN 9 115253900 missense probably benign
IGL01680:Stt3b APN 9 115246261 splice site probably benign
IGL01980:Stt3b APN 9 115276699 splice site probably null
IGL02351:Stt3b APN 9 115250907 missense possibly damaging 0.90
IGL02358:Stt3b APN 9 115250907 missense possibly damaging 0.90
IGL02421:Stt3b APN 9 115251852 splice site probably benign
IGL02602:Stt3b APN 9 115276778 missense probably damaging 1.00
IGL03231:Stt3b APN 9 115243994 missense unknown
R0482:Stt3b UTSW 9 115248567 missense probably benign 0.10
R1221:Stt3b UTSW 9 115257499 missense probably benign 0.00
R1437:Stt3b UTSW 9 115254927 missense probably damaging 1.00
R1477:Stt3b UTSW 9 115266192 missense probably damaging 1.00
R1604:Stt3b UTSW 9 115250927 missense probably damaging 1.00
R1796:Stt3b UTSW 9 115248607 nonsense probably null
R4112:Stt3b UTSW 9 115266138 missense probably damaging 1.00
R4166:Stt3b UTSW 9 115254901 missense probably damaging 1.00
R4695:Stt3b UTSW 9 115254794 missense probably damaging 1.00
R5183:Stt3b UTSW 9 115266143 missense probably damaging 0.99
R5317:Stt3b UTSW 9 115252510 nonsense probably null
R5631:Stt3b UTSW 9 115254845 missense probably benign 0.05
R5665:Stt3b UTSW 9 115266147 missense probably damaging 1.00
R6495:Stt3b UTSW 9 115267320 missense possibly damaging 0.46
R6525:Stt3b UTSW 9 115258558 missense probably damaging 1.00
R6593:Stt3b UTSW 9 115252511 missense probably damaging 0.99
R7065:Stt3b UTSW 9 115266156 missense probably damaging 1.00
R7071:Stt3b UTSW 9 115254017 missense probably damaging 1.00
R7297:Stt3b UTSW 9 115276957 missense probably damaging 1.00
R7313:Stt3b UTSW 9 115266115 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GGTTATCAAATCAACTGATGAGGAC -3'
(R):5'- AGGCTCCAGTTTATTGACATTAACC -3'

Sequencing Primer
(F):5'- CAACTGATGAGGACATACATTAGC -3'
(R):5'- TTTCATGGCAGAAAATGAAAACAG -3'
Posted On2018-06-06