Incidental Mutation 'R6542:Prom1'
ID520823
Institutional Source Beutler Lab
Gene Symbol Prom1
Ensembl Gene ENSMUSG00000029086
Gene Nameprominin 1
Synonyms4932416E19Rik, Prom, AC133, CD133, Prom-1
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.447) question?
Stock #R6542 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location43993620-44102032 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 44037509 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 298 (D298G)
Ref Sequence ENSEMBL: ENSMUSP00000030973 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030973] [ENSMUST00000074113] [ENSMUST00000087441] [ENSMUST00000087442] [ENSMUST00000165909] [ENSMUST00000171543] [ENSMUST00000177946] [ENSMUST00000179059] [ENSMUST00000197706] [ENSMUST00000197750]
Predicted Effect possibly damaging
Transcript: ENSMUST00000030973
AA Change: D298G

PolyPhen 2 Score 0.839 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000030973
Gene: ENSMUSG00000029086
AA Change: D298G

DomainStartEndE-ValueType
Pfam:Prominin 11 326 1.5e-113 PFAM
Pfam:Prominin 322 798 4.6e-188 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000074113
AA Change: D307G

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000073751
Gene: ENSMUSG00000029086
AA Change: D307G

DomainStartEndE-ValueType
low complexity region 8 13 N/A INTRINSIC
Pfam:Prominin 18 822 2e-294 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000087441
AA Change: D298G

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000084707
Gene: ENSMUSG00000029086
AA Change: D298G

DomainStartEndE-ValueType
Pfam:Prominin 11 823 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000087442
AA Change: D298G

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000084709
Gene: ENSMUSG00000029086
AA Change: D298G

DomainStartEndE-ValueType
Pfam:Prominin 11 823 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000165909
AA Change: D298G

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000129909
Gene: ENSMUSG00000029086
AA Change: D298G

DomainStartEndE-ValueType
Pfam:Prominin 11 823 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000171543
AA Change: D307G

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000128978
Gene: ENSMUSG00000029086
AA Change: D307G

DomainStartEndE-ValueType
Pfam:Prominin 11 838 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000177946
AA Change: D298G

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000136483
Gene: ENSMUSG00000029086
AA Change: D298G

DomainStartEndE-ValueType
Pfam:Prominin 11 823 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000179059
AA Change: D307G

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000137557
Gene: ENSMUSG00000029086
AA Change: D307G

DomainStartEndE-ValueType
Pfam:Prominin 11 838 N/A PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196853
Predicted Effect probably benign
Transcript: ENSMUST00000197706
AA Change: D293G

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000142632
Gene: ENSMUSG00000029086
AA Change: D293G

DomainStartEndE-ValueType
Pfam:Prominin 11 321 6.6e-110 PFAM
Pfam:Prominin 317 793 6.8e-188 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197749
Predicted Effect probably benign
Transcript: ENSMUST00000197750
AA Change: D298G

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000142375
Gene: ENSMUSG00000029086
AA Change: D298G

DomainStartEndE-ValueType
Pfam:Prominin 11 823 N/A PFAM
Predicted Effect unknown
Transcript: ENSMUST00000198347
AA Change: D92G
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199739
Meta Mutation Damage Score 0.0612 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.1%
Validation Efficiency 98% (47/48)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a pentaspan transmembrane glycoprotein. The protein localizes to membrane protrusions and is often expressed on adult stem cells, where it is thought to function in maintaining stem cell properties by suppressing differentiation. Mutations in this gene have been shown to result in retinitis pigmentosa and Stargardt disease. Expression of this gene is also associated with several types of cancer. This gene is expressed from at least five alternative promoters that are expressed in a tissue-dependent manner. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2009]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit abnormal retina morphology, vasculature, and electrophysiology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aasdh A T 5: 76,883,055 L566Q probably damaging Het
Apbb1ip C T 2: 22,874,960 T551I probably benign Het
Aqp5 A G 15: 99,594,262 E247G probably damaging Het
Bdkrb1 T C 12: 105,605,093 F306S probably damaging Het
Ccdc114 G T 7: 45,948,390 A575S probably benign Het
Clca3a1 C T 3: 144,759,260 V71I probably benign Het
Cog4 A G 8: 110,851,362 D36G probably damaging Het
Ctbp1 A G 5: 33,269,571 probably benign Het
Dync1li2 C T 8: 104,442,764 G13D probably benign Het
F5 T C 1: 164,194,468 V1504A probably benign Het
Fancm T C 12: 65,097,429 L555P probably damaging Het
Fgfr2 A T 7: 130,201,123 S152T probably benign Het
Fign A T 2: 63,980,295 H210Q possibly damaging Het
Hbs1l A G 10: 21,304,617 N66S probably benign Het
Ighv12-3 A T 12: 114,366,815 M20K probably benign Het
Isoc2b T C 7: 4,851,455 K26E probably damaging Het
Katnal1 C T 5: 148,876,206 A467T probably benign Het
Loxl3 A G 6: 83,048,166 T292A probably benign Het
Map3k9 A G 12: 81,722,254 S1007P possibly damaging Het
Mcur1 A T 13: 43,551,658 V174D probably damaging Het
Metrnl A C 11: 121,702,878 probably null Het
Midn A G 10: 80,156,584 D490G probably damaging Het
Mmp10 G A 9: 7,506,512 A330T probably benign Het
Mto1 T A 9: 78,457,228 C281S possibly damaging Het
Nek10 A G 14: 14,999,108 I1036V probably benign Het
Olfr1535 T C 13: 21,555,507 T172A probably damaging Het
Olfr157 A C 4: 43,835,686 L268R probably benign Het
Olfr374 T C 8: 72,109,871 F102L probably damaging Het
Olfr912 C A 9: 38,539,437 L181I probably benign Het
Parp4 A C 14: 56,647,882 I1473L unknown Het
Pcdhb9 A G 18: 37,401,589 Y212C probably damaging Het
Pilra G T 5: 137,821,975 probably null Het
Pkhd1 A G 1: 20,585,703 I202T probably benign Het
Ppfia2 A T 10: 106,835,725 E432D probably damaging Het
Prr22 T A 17: 56,770,527 probably null Het
Sept2 T A 1: 93,497,466 probably null Het
Setdb1 C A 3: 95,340,307 V426L probably damaging Het
Slc8b1 C T 5: 120,529,517 A405V probably damaging Het
Srrm1 G A 4: 135,340,926 R279* probably null Het
Ssh2 C G 11: 77,450,150 D709E possibly damaging Het
Tmprss9 A G 10: 80,888,555 D373G probably damaging Het
Trpm3 T C 19: 22,926,113 L921S probably benign Het
Ubqln3 T C 7: 104,141,617 N422S probably benign Het
Vmn2r105 C T 17: 20,228,541 V125I probably benign Het
Vmn2r69 A T 7: 85,411,205 Y390* probably null Het
Zcwpw1 T C 5: 137,812,020 F353L probably damaging Het
Zfp462 G A 4: 55,023,433 C987Y probably damaging Het
Zkscan4 A G 13: 21,484,338 S320G probably damaging Het
Other mutations in Prom1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00158:Prom1 APN 5 44055937 missense probably damaging 1.00
IGL00392:Prom1 APN 5 44007021 critical splice donor site probably null
IGL00771:Prom1 APN 5 44029776 splice site probably benign
IGL00841:Prom1 APN 5 44063116 splice site probably benign
IGL01780:Prom1 APN 5 44029604 splice site probably benign
IGL01991:Prom1 APN 5 44047506 missense probably benign 0.13
IGL02220:Prom1 APN 5 44014789 missense probably damaging 1.00
IGL02350:Prom1 APN 5 44029604 splice site probably benign
IGL02357:Prom1 APN 5 44029604 splice site probably benign
IGL02420:Prom1 APN 5 44063154 missense probably benign 0.15
IGL02468:Prom1 APN 5 44029698 missense probably benign 0.01
IGL02633:Prom1 APN 5 44014775 missense probably benign 0.20
IGL02871:Prom1 APN 5 44029676 missense probably damaging 1.00
IGL02967:Prom1 APN 5 44044398 missense probably damaging 1.00
IGL03033:Prom1 APN 5 44006160 splice site probably null
IGL03072:Prom1 APN 5 44058662 intron probably benign
IGL03149:Prom1 APN 5 44029734 missense probably damaging 0.99
IGL03277:Prom1 APN 5 44032971 nonsense probably null
R1018:Prom1 UTSW 5 44029714 missense probably benign 0.02
R1456:Prom1 UTSW 5 44037623 missense probably damaging 0.96
R1458:Prom1 UTSW 5 44032932 splice site probably benign
R1536:Prom1 UTSW 5 44018353 missense probably benign 0.39
R1747:Prom1 UTSW 5 44007031 missense probably benign 0.03
R1772:Prom1 UTSW 5 44011224 missense probably benign 0.00
R2020:Prom1 UTSW 5 44011253 splice site probably benign
R2022:Prom1 UTSW 5 44029726 missense probably benign 0.18
R2091:Prom1 UTSW 5 44014086 splice site probably benign
R2163:Prom1 UTSW 5 44014163 missense possibly damaging 0.72
R2177:Prom1 UTSW 5 44026739 missense possibly damaging 0.67
R3015:Prom1 UTSW 5 44034391 missense probably damaging 1.00
R3022:Prom1 UTSW 5 44047574 missense probably damaging 1.00
R4824:Prom1 UTSW 5 44034390 missense probably damaging 0.98
R4909:Prom1 UTSW 5 44045552 missense probably benign 0.00
R4999:Prom1 UTSW 5 44037534 missense probably benign 0.00
R5082:Prom1 UTSW 5 44000832 unclassified probably null
R5351:Prom1 UTSW 5 44044355 missense probably damaging 1.00
R5401:Prom1 UTSW 5 44000805 missense probably damaging 0.99
R5440:Prom1 UTSW 5 44058646 missense probably benign
R5529:Prom1 UTSW 5 44026768 missense probably damaging 1.00
R5537:Prom1 UTSW 5 44000776 critical splice donor site probably null
R5669:Prom1 UTSW 5 44012943 missense possibly damaging 0.64
R5723:Prom1 UTSW 5 44014894 missense probably benign 0.30
R5778:Prom1 UTSW 5 44007047 missense probably benign 0.13
R5924:Prom1 UTSW 5 44004963 missense probably benign 0.02
R6034:Prom1 UTSW 5 44044408 critical splice acceptor site probably null
R6034:Prom1 UTSW 5 44044408 critical splice acceptor site probably null
R6038:Prom1 UTSW 5 44001793 missense probably damaging 1.00
R6038:Prom1 UTSW 5 44001793 missense probably damaging 1.00
R6145:Prom1 UTSW 5 44029649 missense probably benign 0.05
R6374:Prom1 UTSW 5 44055983 missense probably damaging 1.00
R6645:Prom1 UTSW 5 44047514 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TCCCGAAAAGAGTCCCAGAG -3'
(R):5'- GAGATACTCTTCTGGCCAGTTC -3'

Sequencing Primer
(F):5'- AGAGCACCAGATGTTACTCCTTG -3'
(R):5'- CTGATTCTGGCTATGTTCTTACAG -3'
Posted On2018-06-06