Incidental Mutation 'R6517:Senp2'
ID520828
Institutional Source Beutler Lab
Gene Symbol Senp2
Ensembl Gene ENSMUSG00000022855
Gene NameSUMO/sentrin specific peptidase 2
Synonyms4930538C18Rik, 2310007L05Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6517 (G1)
Quality Score225.009
Status Not validated
Chromosome16
Chromosomal Location22009484-22049269 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 22026724 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Methionine at position 236 (T236M)
Ref Sequence ENSEMBL: ENSMUSP00000023561 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023561] [ENSMUST00000231724] [ENSMUST00000232534] [ENSMUST00000232679]
Predicted Effect possibly damaging
Transcript: ENSMUST00000023561
AA Change: T236M

PolyPhen 2 Score 0.955 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000023561
Gene: ENSMUSG00000022855
AA Change: T236M

DomainStartEndE-ValueType
low complexity region 23 40 N/A INTRINSIC
low complexity region 101 118 N/A INTRINSIC
low complexity region 325 340 N/A INTRINSIC
Pfam:Peptidase_C48 408 587 1.5e-40 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000231724
Predicted Effect probably benign
Transcript: ENSMUST00000231798
Predicted Effect probably benign
Transcript: ENSMUST00000232263
Predicted Effect probably benign
Transcript: ENSMUST00000232534
Predicted Effect probably benign
Transcript: ENSMUST00000232679
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] SUMO1 (UBL1; MIM 601912) is a small ubiquitin-like protein that can be covalently conjugated to other proteins. SENP2 is one of a group of enzymes that process newly synthesized SUMO1 into the conjugatable form and catalyze the deconjugation of SUMO1-containing species.[supplied by OMIM, Apr 2004]
PHENOTYPE: Homozygous null mice are embryonic lethal due to placental defects resulting from abnormal trophoblast maturation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actr8 C T 14: 29,982,716 Q58* probably null Het
Adamts20 A C 15: 94,283,104 probably null Het
Alpk3 T A 7: 81,078,579 S486T possibly damaging Het
Cep162 T A 9: 87,222,174 E553V probably damaging Het
Epha5 T C 5: 84,156,501 I370V possibly damaging Het
Ets1 A T 9: 32,752,797 probably null Het
Fbxo38 C T 18: 62,533,563 E180K probably damaging Het
Fscn1 A G 5: 142,971,986 D296G probably damaging Het
Glul A G 1: 153,908,033 I325V probably benign Het
Keg1 A G 19: 12,715,910 D99G probably benign Het
Krt1 A T 15: 101,850,267 V154D possibly damaging Het
Mdfic T A 6: 15,770,325 I110N probably damaging Het
Myo1g T C 11: 6,512,509 N541D probably damaging Het
Nos3 T A 5: 24,383,624 V1116D probably damaging Het
Olfr1098 A G 2: 86,923,097 I145T probably benign Het
Piwil2 G T 14: 70,374,336 Q954K probably benign Het
Ppm1l T C 3: 69,317,583 M6T probably damaging Het
Scn3a T A 2: 65,497,563 E861V possibly damaging Het
Sgo2b A T 8: 63,931,494 V156D probably damaging Het
Sis T C 3: 72,907,142 Y1585C probably damaging Het
Slc22a22 A G 15: 57,250,969 S321P probably benign Het
Slu7 T A 11: 43,438,148 Y66N probably damaging Het
Stra6l A G 4: 45,879,473 H365R probably benign Het
Stt3b T C 9: 115,267,342 T246A probably benign Het
Taf1c T G 8: 119,604,247 N44T possibly damaging Het
Tcirg1 C T 19: 3,901,933 V376M probably damaging Het
Tkt A G 14: 30,549,323 D17G probably damaging Het
Tle6 G A 10: 81,591,976 H482Y probably damaging Het
Tnks1bp1 T C 2: 85,059,345 V672A probably benign Het
Zdbf2 T G 1: 63,305,520 D1019E possibly damaging Het
Zfp608 A T 18: 54,899,078 C597S possibly damaging Het
Zfp986 G C 4: 145,899,300 D177H probably benign Het
Other mutations in Senp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00788:Senp2 APN 16 22018364 missense probably damaging 1.00
IGL01562:Senp2 APN 16 22009687 missense probably damaging 1.00
IGL01757:Senp2 APN 16 22009664 missense probably benign 0.13
IGL02593:Senp2 APN 16 22044271 missense probably damaging 1.00
IGL02896:Senp2 APN 16 22018368 nonsense probably null
IGL03219:Senp2 APN 16 22014264 splice site probably benign
IGL03244:Senp2 APN 16 22040579 missense probably damaging 0.97
PIT1430001:Senp2 UTSW 16 22014114 splice site probably benign
R0410:Senp2 UTSW 16 22009694 missense probably damaging 0.99
R0511:Senp2 UTSW 16 22036570 missense probably benign 0.01
R1186:Senp2 UTSW 16 22011504 missense probably damaging 0.99
R1689:Senp2 UTSW 16 22026666 missense probably damaging 0.98
R1723:Senp2 UTSW 16 22028042 missense probably benign 0.00
R1776:Senp2 UTSW 16 22043060 splice site probably benign
R2056:Senp2 UTSW 16 22014199 missense probably damaging 1.00
R2058:Senp2 UTSW 16 22014199 missense probably damaging 1.00
R2371:Senp2 UTSW 16 22018375 missense possibly damaging 0.86
R3838:Senp2 UTSW 16 22009735 missense probably damaging 0.99
R3839:Senp2 UTSW 16 22009735 missense probably damaging 0.99
R4001:Senp2 UTSW 16 22028568 missense possibly damaging 0.95
R4190:Senp2 UTSW 16 22046667 missense probably damaging 1.00
R4191:Senp2 UTSW 16 22046667 missense probably damaging 1.00
R4193:Senp2 UTSW 16 22046667 missense probably damaging 1.00
R4231:Senp2 UTSW 16 22011554 critical splice donor site probably null
R4435:Senp2 UTSW 16 22014241 missense possibly damaging 0.83
R4847:Senp2 UTSW 16 22038636 missense possibly damaging 0.90
R5207:Senp2 UTSW 16 22041380 missense possibly damaging 0.52
R5509:Senp2 UTSW 16 22040522 missense probably damaging 1.00
R6036:Senp2 UTSW 16 22028558 nonsense probably null
R6036:Senp2 UTSW 16 22028558 nonsense probably null
R6475:Senp2 UTSW 16 22023800 missense probably damaging 1.00
R6923:Senp2 UTSW 16 22011576 intron probably benign
Predicted Primers PCR Primer
(F):5'- TGCTCCAAGTGAAGTCTGTCTG -3'
(R):5'- TTCATGTGGGCAAAGGACTG -3'

Sequencing Primer
(F):5'- CAAGTGAAGTCTGTCTGTGGCTAC -3'
(R):5'- TTCATGTGGGCAAAGGACTGTAAAAC -3'
Posted On2018-06-06