Incidental Mutation 'R6517:Tcirg1'
ID 520834
Institutional Source Beutler Lab
Gene Symbol Tcirg1
Ensembl Gene ENSMUSG00000001750
Gene Name T cell, immune regulator 1, ATPase, H+ transporting, lysosomal V0 protein A3
Synonyms OC-116, TIRC7, V-ATPase a3, ATP6a3, Atp6i
MMRRC Submission 044644-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.857) question?
Stock # R6517 (G1)
Quality Score 225.009
Status Not validated
Chromosome 19
Chromosomal Location 3946050-3957133 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 3951933 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Methionine at position 376 (V376M)
Ref Sequence ENSEMBL: ENSMUSP00000122474 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001801] [ENSMUST00000122885] [ENSMUST00000126070] [ENSMUST00000145791] [ENSMUST00000135070]
AlphaFold Q9JHF5
Predicted Effect probably damaging
Transcript: ENSMUST00000001801
AA Change: V376M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000001801
Gene: ENSMUSG00000001750
AA Change: V376M

DomainStartEndE-ValueType
Pfam:V_ATPase_I 26 830 4.4e-287 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000122885
AA Change: V31M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000114768
Gene: ENSMUSG00000001750
AA Change: V31M

DomainStartEndE-ValueType
Pfam:V_ATPase_I 1 91 2.9e-44 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125792
Predicted Effect probably damaging
Transcript: ENSMUST00000126070
AA Change: V376M

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000120531
Gene: ENSMUSG00000001750
AA Change: V376M

DomainStartEndE-ValueType
Pfam:V_ATPase_I 27 829 1.2e-277 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126643
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127308
Predicted Effect probably damaging
Transcript: ENSMUST00000145791
AA Change: V376M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000122474
Gene: ENSMUSG00000001750
AA Change: V376M

DomainStartEndE-ValueType
Pfam:V_ATPase_I 26 830 4.4e-287 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159824
Predicted Effect probably benign
Transcript: ENSMUST00000132164
SMART Domains Protein: ENSMUSP00000120968
Gene: ENSMUSG00000001750

DomainStartEndE-ValueType
Pfam:V_ATPase_I 1 190 4.5e-48 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000135070
SMART Domains Protein: ENSMUSP00000121241
Gene: ENSMUSG00000001750

DomainStartEndE-ValueType
low complexity region 59 70 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131327
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134698
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162688
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Through alternate splicing, this gene encodes two proteins with similarity to subunits of the vacuolar ATPase (V-ATPase) but the encoded proteins seem to have different functions. V-ATPase is a multisubunit enzyme that mediates acidification of eukaryotic intracellular organelles. V-ATPase dependent organelle acidification is necessary for such intracellular processes as protein sorting, zymogen activation, and receptor-mediated endocytosis. V-ATPase is comprised of a cytosolic V1 domain and a transmembrane V0 domain. Mutations in this gene are associated with infantile malignant osteopetrosis. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for mutant alleles exhibit severe osteopetrosis with increased bone density due to failure of secondary bone resorption. Mutants lack teeth and die around 30-40 days of age. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actr8 C T 14: 29,704,673 (GRCm39) Q58* probably null Het
Adamts20 A C 15: 94,180,985 (GRCm39) probably null Het
Alpk3 T A 7: 80,728,327 (GRCm39) S486T possibly damaging Het
Cep162 T A 9: 87,104,227 (GRCm39) E553V probably damaging Het
Epha5 T C 5: 84,304,360 (GRCm39) I370V possibly damaging Het
Ets1 A T 9: 32,664,093 (GRCm39) probably null Het
Fbxo38 C T 18: 62,666,634 (GRCm39) E180K probably damaging Het
Fscn1 A G 5: 142,957,741 (GRCm39) D296G probably damaging Het
Glul A G 1: 153,783,779 (GRCm39) I325V probably benign Het
Keg1 A G 19: 12,693,274 (GRCm39) D99G probably benign Het
Krt1 A T 15: 101,758,702 (GRCm39) V154D possibly damaging Het
Mdfic T A 6: 15,770,324 (GRCm39) I110N probably damaging Het
Myo1g T C 11: 6,462,509 (GRCm39) N541D probably damaging Het
Nos3 T A 5: 24,588,622 (GRCm39) V1116D probably damaging Het
Or8h8 A G 2: 86,753,441 (GRCm39) I145T probably benign Het
Piwil2 G T 14: 70,611,785 (GRCm39) Q954K probably benign Het
Ppm1l T C 3: 69,224,916 (GRCm39) M6T probably damaging Het
Scn3a T A 2: 65,327,907 (GRCm39) E861V possibly damaging Het
Senp2 C T 16: 21,845,474 (GRCm39) T236M possibly damaging Het
Sgo2b A T 8: 64,384,528 (GRCm39) V156D probably damaging Het
Sis T C 3: 72,814,475 (GRCm39) Y1585C probably damaging Het
Slc22a22 A G 15: 57,114,365 (GRCm39) S321P probably benign Het
Slu7 T A 11: 43,328,975 (GRCm39) Y66N probably damaging Het
Stra6l A G 4: 45,879,473 (GRCm39) H365R probably benign Het
Stt3b T C 9: 115,096,410 (GRCm39) T246A probably benign Het
Taf1c T G 8: 120,330,986 (GRCm39) N44T possibly damaging Het
Tkt A G 14: 30,271,280 (GRCm39) D17G probably damaging Het
Tle6 G A 10: 81,427,810 (GRCm39) H482Y probably damaging Het
Tnks1bp1 T C 2: 84,889,689 (GRCm39) V672A probably benign Het
Zdbf2 T G 1: 63,344,679 (GRCm39) D1019E possibly damaging Het
Zfp608 A T 18: 55,032,150 (GRCm39) C597S possibly damaging Het
Zfp986 G C 4: 145,625,870 (GRCm39) D177H probably benign Het
Other mutations in Tcirg1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00488:Tcirg1 APN 19 3,949,108 (GRCm39) missense possibly damaging 0.94
IGL01735:Tcirg1 APN 19 3,954,210 (GRCm39) splice site probably benign
IGL03143:Tcirg1 APN 19 3,948,811 (GRCm39) missense probably damaging 1.00
R0732:Tcirg1 UTSW 19 3,947,866 (GRCm39) missense possibly damaging 0.56
R1131:Tcirg1 UTSW 19 3,946,301 (GRCm39) missense probably damaging 1.00
R1223:Tcirg1 UTSW 19 3,948,733 (GRCm39) missense probably benign 0.01
R1548:Tcirg1 UTSW 19 3,946,845 (GRCm39) missense probably benign 0.03
R1867:Tcirg1 UTSW 19 3,948,835 (GRCm39) missense probably damaging 1.00
R1926:Tcirg1 UTSW 19 3,952,843 (GRCm39) intron probably benign
R2262:Tcirg1 UTSW 19 3,953,591 (GRCm39) missense possibly damaging 0.89
R4367:Tcirg1 UTSW 19 3,949,069 (GRCm39) missense probably damaging 1.00
R5327:Tcirg1 UTSW 19 3,952,342 (GRCm39) critical splice donor site probably null
R5417:Tcirg1 UTSW 19 3,953,509 (GRCm39) splice site probably null
R5551:Tcirg1 UTSW 19 3,948,858 (GRCm39) missense probably damaging 1.00
R5930:Tcirg1 UTSW 19 3,952,424 (GRCm39) missense possibly damaging 0.95
R6026:Tcirg1 UTSW 19 3,947,487 (GRCm39) missense probably benign
R7039:Tcirg1 UTSW 19 3,946,666 (GRCm39) missense probably damaging 1.00
R7181:Tcirg1 UTSW 19 3,953,576 (GRCm39) missense probably null 0.56
R7422:Tcirg1 UTSW 19 3,949,008 (GRCm39) missense possibly damaging 0.61
R7631:Tcirg1 UTSW 19 3,947,160 (GRCm39) missense probably damaging 1.00
R7768:Tcirg1 UTSW 19 3,952,900 (GRCm39) missense possibly damaging 0.91
R7899:Tcirg1 UTSW 19 3,949,104 (GRCm39) missense probably damaging 1.00
R8110:Tcirg1 UTSW 19 3,949,099 (GRCm39) missense probably damaging 1.00
R8535:Tcirg1 UTSW 19 3,946,324 (GRCm39) missense probably damaging 1.00
R9233:Tcirg1 UTSW 19 3,952,543 (GRCm39) missense probably damaging 1.00
R9292:Tcirg1 UTSW 19 3,947,840 (GRCm39) missense probably damaging 1.00
R9611:Tcirg1 UTSW 19 3,953,400 (GRCm39) missense probably benign 0.09
R9695:Tcirg1 UTSW 19 3,952,360 (GRCm39) missense probably null 0.69
Z1176:Tcirg1 UTSW 19 3,953,425 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TTGCACTCCAAAGGCAAGG -3'
(R):5'- TACAGTCCACATCTCAGCTGG -3'

Sequencing Primer
(F):5'- GCAAGGGCCTAACTTCTACC -3'
(R):5'- ACATCTCAGCTGGGCCTG -3'
Posted On 2018-06-06