Incidental Mutation 'R6542:Fancm'
ID520866
Institutional Source Beutler Lab
Gene Symbol Fancm
Ensembl Gene ENSMUSG00000055884
Gene NameFanconi anemia, complementation group M
SynonymsD12Ertd364e, C730036B14Rik
MMRRC Submission
Accession Numbers

Ncbi RefSeq: NM_178912.3; MGI:2442306

Is this an essential gene? Probably essential (E-score: 0.825) question?
Stock #R6542 (G1)
Quality Score225.009
Status Validated
Chromosome12
Chromosomal Location65075603-65132058 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 65097429 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 555 (L555P)
Ref Sequence ENSEMBL: ENSMUSP00000152854 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058889] [ENSMUST00000222540]
Predicted Effect probably damaging
Transcript: ENSMUST00000058889
AA Change: L555P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000054797
Gene: ENSMUSG00000055884
AA Change: L555P

DomainStartEndE-ValueType
DEXDc 75 275 5.6e-25 SMART
Blast:DEXDc 295 323 9e-6 BLAST
low complexity region 339 348 N/A INTRINSIC
HELICc 475 566 5.64e-21 SMART
Pfam:FANCM-MHF_bd 657 770 8.5e-50 PFAM
low complexity region 850 866 N/A INTRINSIC
low complexity region 974 987 N/A INTRINSIC
low complexity region 1105 1120 N/A INTRINSIC
low complexity region 1165 1178 N/A INTRINSIC
PDB:4DAY|C 1207 1238 1e-6 PDB
low complexity region 1489 1506 N/A INTRINSIC
low complexity region 1572 1586 N/A INTRINSIC
low complexity region 1669 1682 N/A INTRINSIC
ERCC4 1780 1863 2.07e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000221937
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222521
Predicted Effect probably damaging
Transcript: ENSMUST00000222540
AA Change: L555P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223051
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223249
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223401
Meta Mutation Damage Score 0.504 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.1%
Validation Efficiency 98% (47/48)
MGI Phenotype Strain: 4355560
Lethality: D500-D600
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The Fanconi anemia complementation group (FANC) currently includes FANCA, FANCB, FANCC, FANCD1 (also called BRCA2), FANCD2, FANCE, FANCF, FANCG, FANCI, FANCJ (also called BRIP1), FANCL, FANCM and FANCN (also called PALB2). The previously defined group FANCH is the same as FANCA. Fanconi anemia is a genetically heterogeneous recessive disorder characterized by cytogenetic instability, hypersensitivity to DNA crosslinking agents, increased chromosomal breakage, and defective DNA repair. The members of the Fanconi anemia complementation group do not share sequence similarity; they are related by their assembly into a common nuclear protein complex. This gene encodes the protein for complementation group M. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2015]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit reduced female transmission, hypogonadism, premature death, and increased incidence of tumors. [provided by MGI curators]
Allele List at MGI

All alleles(39) : Targeted(4) Gene trapped(35)

Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aasdh A T 5: 76,883,055 L566Q probably damaging Het
Apbb1ip C T 2: 22,874,960 T551I probably benign Het
Aqp5 A G 15: 99,594,262 E247G probably damaging Het
Bdkrb1 T C 12: 105,605,093 F306S probably damaging Het
Ccdc114 G T 7: 45,948,390 A575S probably benign Het
Clca3a1 C T 3: 144,759,260 V71I probably benign Het
Cog4 A G 8: 110,851,362 D36G probably damaging Het
Ctbp1 A G 5: 33,269,571 probably benign Het
Dync1li2 C T 8: 104,442,764 G13D probably benign Het
F5 T C 1: 164,194,468 V1504A probably benign Het
Fgfr2 A T 7: 130,201,123 S152T probably benign Het
Fign A T 2: 63,980,295 H210Q possibly damaging Het
Hbs1l A G 10: 21,304,617 N66S probably benign Het
Ighv12-3 A T 12: 114,366,815 M20K probably benign Het
Isoc2b T C 7: 4,851,455 K26E probably damaging Het
Katnal1 C T 5: 148,876,206 A467T probably benign Het
Loxl3 A G 6: 83,048,166 T292A probably benign Het
Map3k9 A G 12: 81,722,254 S1007P possibly damaging Het
Mcur1 A T 13: 43,551,658 V174D probably damaging Het
Metrnl A C 11: 121,702,878 probably null Het
Midn A G 10: 80,156,584 D490G probably damaging Het
Mmp10 G A 9: 7,506,512 A330T probably benign Het
Mto1 T A 9: 78,457,228 C281S possibly damaging Het
Nek10 A G 14: 14,999,108 I1036V probably benign Het
Olfr1535 T C 13: 21,555,507 T172A probably damaging Het
Olfr157 A C 4: 43,835,686 L268R probably benign Het
Olfr374 T C 8: 72,109,871 F102L probably damaging Het
Olfr912 C A 9: 38,539,437 L181I probably benign Het
Parp4 A C 14: 56,647,882 I1473L unknown Het
Pcdhb9 A G 18: 37,401,589 Y212C probably damaging Het
Pilra G T 5: 137,821,975 probably null Het
Pkhd1 A G 1: 20,585,703 I202T probably benign Het
Ppfia2 A T 10: 106,835,725 E432D probably damaging Het
Prom1 T C 5: 44,037,509 D298G possibly damaging Het
Prr22 T A 17: 56,770,527 probably null Het
Sept2 T A 1: 93,497,466 probably null Het
Setdb1 C A 3: 95,340,307 V426L probably damaging Het
Slc8b1 C T 5: 120,529,517 A405V probably damaging Het
Srrm1 G A 4: 135,340,926 R279* probably null Het
Ssh2 C G 11: 77,450,150 D709E possibly damaging Het
Tmprss9 A G 10: 80,888,555 D373G probably damaging Het
Trpm3 T C 19: 22,926,113 L921S probably benign Het
Ubqln3 T C 7: 104,141,617 N422S probably benign Het
Vmn2r105 C T 17: 20,228,541 V125I probably benign Het
Vmn2r69 A T 7: 85,411,205 Y390* probably null Het
Zcwpw1 T C 5: 137,812,020 F353L probably damaging Het
Zfp462 G A 4: 55,023,433 C987Y probably damaging Het
Zkscan4 A G 13: 21,484,338 S320G probably damaging Het
Other mutations in Fancm
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00158:Fancm APN 12 65075736 missense possibly damaging 0.50
IGL00489:Fancm APN 12 65106193 missense probably benign 0.01
IGL00529:Fancm APN 12 65130417 utr 3 prime probably benign
IGL00898:Fancm APN 12 65106000 missense probably benign 0.01
IGL01805:Fancm APN 12 65113861 critical splice donor site probably null
IGL01986:Fancm APN 12 65126655 nonsense probably null
IGL02026:Fancm APN 12 65105734 missense probably benign 0.03
IGL02069:Fancm APN 12 65075911 missense probably benign 0.05
IGL02103:Fancm APN 12 65095784 missense probably benign 0.38
IGL02133:Fancm APN 12 65106475 missense probably benign 0.04
IGL02400:Fancm APN 12 65113815 missense probably damaging 1.00
IGL02478:Fancm APN 12 65077090 missense probably damaging 1.00
IGL02479:Fancm APN 12 65106485 missense probably damaging 0.98
IGL02563:Fancm APN 12 65092462 missense probably damaging 1.00
IGL02606:Fancm APN 12 65076139 missense possibly damaging 0.90
IGL02731:Fancm APN 12 65088305 missense probably benign 0.00
IGL02809:Fancm APN 12 65121667 missense possibly damaging 0.54
IGL02953:Fancm APN 12 65121966 missense probably benign 0.27
IGL03066:Fancm APN 12 65125114 nonsense probably null
IGL03073:Fancm APN 12 65101632 missense probably damaging 1.00
PIT4131001:Fancm UTSW 12 65105422 missense probably benign 0.03
R0041:Fancm UTSW 12 65106443 nonsense probably null
R0041:Fancm UTSW 12 65106443 nonsense probably null
R0125:Fancm UTSW 12 65121956 missense possibly damaging 0.68
R0201:Fancm UTSW 12 65101632 missense probably damaging 1.00
R0360:Fancm UTSW 12 65075950 missense probably damaging 1.00
R0491:Fancm UTSW 12 65106061 missense probably benign 0.32
R0557:Fancm UTSW 12 65118442 critical splice donor site probably null
R0617:Fancm UTSW 12 65097317 nonsense probably null
R1201:Fancm UTSW 12 65106768 missense possibly damaging 0.66
R1353:Fancm UTSW 12 65088170 missense probably damaging 1.00
R1456:Fancm UTSW 12 65118351 missense possibly damaging 0.48
R1468:Fancm UTSW 12 65099293 missense probably damaging 1.00
R1468:Fancm UTSW 12 65099293 missense probably damaging 1.00
R1521:Fancm UTSW 12 65121704 missense probably benign 0.25
R1530:Fancm UTSW 12 65092490 critical splice donor site probably null
R1559:Fancm UTSW 12 65093689 missense probably benign 0.00
R1632:Fancm UTSW 12 65130331 missense probably damaging 1.00
R1681:Fancm UTSW 12 65105656 missense probably benign 0.03
R1919:Fancm UTSW 12 65105520 missense possibly damaging 0.48
R1969:Fancm UTSW 12 65101692 missense probably benign 0.09
R1971:Fancm UTSW 12 65101692 missense probably benign 0.09
R2117:Fancm UTSW 12 65077174 missense probably damaging 1.00
R2510:Fancm UTSW 12 65113770 splice site probably benign
R2909:Fancm UTSW 12 65124856 missense probably damaging 1.00
R3155:Fancm UTSW 12 65116421 missense probably benign 0.32
R3405:Fancm UTSW 12 65075772 missense probably benign 0.00
R4133:Fancm UTSW 12 65120530 missense probably benign 0.44
R4308:Fancm UTSW 12 65126531 missense probably benign 0.14
R4588:Fancm UTSW 12 65118441 critical splice donor site probably null
R4602:Fancm UTSW 12 65124944 missense probably benign 0.12
R4653:Fancm UTSW 12 65083054 missense probably damaging 0.99
R4702:Fancm UTSW 12 65122052 missense possibly damaging 0.95
R4719:Fancm UTSW 12 65121706 missense possibly damaging 0.64
R4885:Fancm UTSW 12 65102643 nonsense probably null
R4896:Fancm UTSW 12 65075831 missense probably damaging 1.00
R4908:Fancm UTSW 12 65094871 missense probably benign 0.28
R4921:Fancm UTSW 12 65077141 missense probably benign 0.19
R4922:Fancm UTSW 12 65106892 critical splice donor site probably null
R4948:Fancm UTSW 12 65090974 missense probably damaging 1.00
R5103:Fancm UTSW 12 65105858 missense probably damaging 0.99
R5577:Fancm UTSW 12 65130411 utr 3 prime probably benign
R5631:Fancm UTSW 12 65113843 missense probably damaging 0.97
R5741:Fancm UTSW 12 65101615 missense probably benign 0.01
R6137:Fancm UTSW 12 65130382 missense probably damaging 1.00
R6167:Fancm UTSW 12 65094895 missense probably benign 0.42
R6242:Fancm UTSW 12 65116442 missense probably benign 0.01
R6242:Fancm UTSW 12 65116449 missense probably benign 0.00
R6281:Fancm UTSW 12 65088270 missense probably damaging 1.00
R6325:Fancm UTSW 12 65125052 missense probably damaging 1.00
R6434:Fancm UTSW 12 65077168 missense probably damaging 1.00
R6493:Fancm UTSW 12 65097488 missense probably benign 0.04
R6645:Fancm UTSW 12 65106100 missense probably damaging 0.99
R6878:Fancm UTSW 12 65116423 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GGGATGTTCTGAACGCTTTAAAATC -3'
(R):5'- ACATTTGCTCAGGGTGCTG -3'

Sequencing Primer
(F):5'- CCACCTTTTCAAGATGAATGGGG -3'
(R):5'- CTGGGTTCTGGATGCTAGAAGAC -3'
Posted On2018-06-06