Incidental Mutation 'R6543:Prokr2'
ID520898
Institutional Source Beutler Lab
Gene Symbol Prokr2
Ensembl Gene ENSMUSG00000050558
Gene Nameprokineticin receptor 2
SynonymsGpcr73l1, B830005M06Rik, PKR2, EG-VEGRF2, Gpr73l1
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.247) question?
Stock #R6543 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location132337733-132385447 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 132373899 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Leucine at position 53 (Q53L)
Ref Sequence ENSEMBL: ENSMUSP00000124526 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049997] [ENSMUST00000110156] [ENSMUST00000110157] [ENSMUST00000142766]
Predicted Effect probably benign
Transcript: ENSMUST00000049997
AA Change: Q214L

PolyPhen 2 Score 0.129 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000056659
Gene: ENSMUSG00000050558
AA Change: Q214L

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 61 349 3.3e-7 PFAM
Pfam:7tm_1 67 330 8.2e-48 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000110156
AA Change: Q214L

PolyPhen 2 Score 0.129 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000105784
Gene: ENSMUSG00000050558
AA Change: Q214L

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 61 349 3.3e-7 PFAM
Pfam:7tm_1 67 330 1.7e-48 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000110157
SMART Domains Protein: ENSMUSP00000105785
Gene: ENSMUSG00000050558

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 61 153 5.2e-7 PFAM
Pfam:7tm_1 67 155 1.7e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000142766
AA Change: Q53L

PolyPhen 2 Score 0.129 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000124526
Gene: ENSMUSG00000050558
AA Change: Q53L

DomainStartEndE-ValueType
Pfam:7tm_1 1 169 4.9e-19 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.6%
Validation Efficiency 100% (41/41)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Prokineticins are secreted proteins that can promote angiogenesis and induce strong gastrointestinal smooth muscle contraction. The protein encoded by this gene is an integral membrane protein and G protein-coupled receptor for prokineticins. The encoded protein is similar in sequence to GPR73, another G protein-coupled receptor for prokineticins. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a null allele show 50% neonatal lethality, olfactory bulb malformation, and reproductive system atrophy related to a lack of hypothalamic gonadotropin-releasing hormone synthesizing neurons. Homozygotes for another null allele show impaired circadian behavior and thermoregulation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ap4e1 T C 2: 127,066,605 V1091A probably benign Het
Arhgef11 A G 3: 87,733,408 N1320D probably benign Het
Atl3 T A 19: 7,510,098 F126Y probably damaging Het
Borcs5 C T 6: 134,710,180 T167M probably damaging Het
Creld2 A G 15: 88,825,278 T331A probably benign Het
Cuzd1 A G 7: 131,309,768 V494A probably damaging Het
Dclk1 C T 3: 55,500,131 P244S probably damaging Het
Esyt3 T C 9: 99,338,772 N126S possibly damaging Het
Focad T C 4: 88,279,256 S629P unknown Het
Gm11236 A G 4: 73,638,978 E16G probably damaging Het
Gm17660 T C 5: 104,074,875 probably benign Het
Grip1 T C 10: 119,985,594 L389P probably benign Het
Igkv4-91 A T 6: 68,768,598 D105E probably damaging Het
Il20ra G A 10: 19,749,323 A117T probably damaging Het
Il6ra A G 3: 89,876,863 V367A probably damaging Het
Itga8 C T 2: 12,301,644 V47M probably damaging Het
Limk2 T C 11: 3,350,682 Y220C probably damaging Het
Lims1 T A 10: 58,412,451 C243* probably null Het
Man1a C A 10: 53,934,981 G435* probably null Het
Mtor T A 4: 148,545,596 I2250N probably damaging Het
N4bp1 G A 8: 86,861,906 Q135* probably null Het
Nbeal2 A T 9: 110,644,458 D76E probably benign Het
Nbn T C 4: 15,986,605 S669P probably benign Het
Nfrkb C T 9: 31,400,985 Q456* probably null Het
Olfr803 C A 10: 129,691,990 G17V probably benign Het
Pcnx3 C T 19: 5,665,247 A1557T probably benign Het
Pgd C T 4: 149,160,752 probably null Het
Pxmp4 C A 2: 154,588,059 A137S possibly damaging Het
Rasef C T 4: 73,780,519 probably benign Het
Rsg1 T G 4: 141,217,288 V50G probably benign Het
Scrt2 C T 2: 152,093,143 A72V probably benign Het
Sipa1l2 T C 8: 125,450,362 E1171G possibly damaging Het
Slc26a8 T C 17: 28,638,401 T923A possibly damaging Het
Slco1a6 T C 6: 142,133,146 K141R probably benign Het
Slfn5 T A 11: 82,958,666 probably null Het
Sympk A T 7: 19,036,830 H282L probably damaging Het
Tnr A G 1: 159,924,107 Y1324C probably damaging Het
Topaz1 A G 9: 122,748,535 N170S possibly damaging Het
Trav6-3 T C 14: 53,428,762 M1T probably null Het
Trim66 A G 7: 109,475,879 S392P probably benign Het
Ttn T C 2: 76,768,811 T10958A probably damaging Het
Ubr7 A G 12: 102,768,235 K256R probably benign Het
Other mutations in Prokr2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00592:Prokr2 APN 2 132381504 missense probably benign 0.28
IGL01948:Prokr2 APN 2 132373683 missense probably damaging 0.97
IGL02930:Prokr2 APN 2 132373474 missense probably benign 0.00
R0092:Prokr2 UTSW 2 132373597 missense probably damaging 1.00
R0717:Prokr2 UTSW 2 132381334 missense probably damaging 1.00
R1547:Prokr2 UTSW 2 132373602 missense probably damaging 1.00
R1573:Prokr2 UTSW 2 132373764 missense probably damaging 0.99
R2302:Prokr2 UTSW 2 132381184 missense probably damaging 1.00
R2336:Prokr2 UTSW 2 132381439 missense probably damaging 0.99
R2483:Prokr2 UTSW 2 132381175 missense probably damaging 1.00
R4049:Prokr2 UTSW 2 132381494 missense probably benign 0.16
R4518:Prokr2 UTSW 2 132374092 critical splice acceptor site probably null
R4947:Prokr2 UTSW 2 132373653 missense probably damaging 1.00
R5961:Prokr2 UTSW 2 132373675 missense possibly damaging 0.95
R5997:Prokr2 UTSW 2 132381442 missense probably damaging 0.99
R6333:Prokr2 UTSW 2 132373978 missense probably damaging 0.98
R6599:Prokr2 UTSW 2 132373549 missense possibly damaging 0.92
R6623:Prokr2 UTSW 2 132373574 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTCTCGCACTATGGTAAAGC -3'
(R):5'- ACCCTTTGAAACCACGGATG -3'

Sequencing Primer
(F):5'- ATGCCCATGAGCAGTAGC -3'
(R):5'- CGGATGAATTATCAGACCGCTTC -3'
Posted On2018-06-06