Incidental Mutation 'R6543:Mtor'
ID520920
Institutional Source Beutler Lab
Gene Symbol Mtor
Ensembl Gene ENSMUSG00000028991
Gene Namemechanistic target of rapamycin kinase
SynonymsRAPT1, FKBP-rapamycin-associated protein FRAP, RAFT1, flat, Frap1, 2610315D21Rik
MMRRC Submission
Accession Numbers

Ncbi RefSeq: NM_020009.2; MGI:1928394

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6543 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location148448611-148557683 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 148545596 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 2250 (I2250N)
Ref Sequence ENSEMBL: ENSMUSP00000099510 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000103221]
Predicted Effect probably damaging
Transcript: ENSMUST00000103221
AA Change: I2250N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000099510
Gene: ENSMUSG00000028991
AA Change: I2250N

DomainStartEndE-ValueType
low complexity region 7 21 N/A INTRINSIC
low complexity region 179 191 N/A INTRINSIC
low complexity region 277 288 N/A INTRINSIC
low complexity region 774 790 N/A INTRINSIC
DUF3385 854 1024 1.51e-93 SMART
low complexity region 1279 1300 N/A INTRINSIC
Pfam:FAT 1513 1908 2.3e-134 PFAM
Rapamycin_bind 2015 2114 7.94e-61 SMART
PI3Kc 2183 2484 8.84e-121 SMART
FATC 2517 2549 2.11e-15 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129715
Meta Mutation Damage Score 0.652 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.6%
Validation Efficiency 100% (41/41)
MGI Phenotype Strain: 3529989; 4820819; 3512186; 5425404; 3052669
Lethality: E11-E12
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to a family of phosphatidylinositol kinase-related kinases. These kinases mediate cellular responses to stresses such as DNA damage and nutrient deprivation. This protein acts as the target for the cell-cycle arrest and immunosuppressive effects of the FKBP12-rapamycin complex. The ANGPTL7 gene is located in an intron of this gene. [provided by RefSeq, Sep 2008]
PHENOTYPE: Mice homozygous for targeted, gene trap and ENU-induced null alleles exhibit embryonic lethality by E12.5 with abnormal embryogenesis. Mice homozygous for the ENU mutation further exhibit abnormal brain development. [provided by MGI curators]
Allele List at MGI

All alleles(25) : Targeted(12) Gene trapped(12) Chemically induced(1)

Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ap4e1 T C 2: 127,066,605 V1091A probably benign Het
Arhgef11 A G 3: 87,733,408 N1320D probably benign Het
Atl3 T A 19: 7,510,098 F126Y probably damaging Het
Borcs5 C T 6: 134,710,180 T167M probably damaging Het
Creld2 A G 15: 88,825,278 T331A probably benign Het
Cuzd1 A G 7: 131,309,768 V494A probably damaging Het
Dclk1 C T 3: 55,500,131 P244S probably damaging Het
Esyt3 T C 9: 99,338,772 N126S possibly damaging Het
Focad T C 4: 88,279,256 S629P unknown Het
Gm11236 A G 4: 73,638,978 E16G probably damaging Het
Gm17660 T C 5: 104,074,875 probably benign Het
Grip1 T C 10: 119,985,594 L389P probably benign Het
Igkv4-91 A T 6: 68,768,598 D105E probably damaging Het
Il20ra G A 10: 19,749,323 A117T probably damaging Het
Il6ra A G 3: 89,876,863 V367A probably damaging Het
Itga8 C T 2: 12,301,644 V47M probably damaging Het
Limk2 T C 11: 3,350,682 Y220C probably damaging Het
Lims1 T A 10: 58,412,451 C243* probably null Het
Man1a C A 10: 53,934,981 G435* probably null Het
N4bp1 G A 8: 86,861,906 Q135* probably null Het
Nbeal2 A T 9: 110,644,458 D76E probably benign Het
Nbn T C 4: 15,986,605 S669P probably benign Het
Nfrkb C T 9: 31,400,985 Q456* probably null Het
Olfr803 C A 10: 129,691,990 G17V probably benign Het
Pcnx3 C T 19: 5,665,247 A1557T probably benign Het
Pgd C T 4: 149,160,752 probably null Het
Prokr2 T A 2: 132,373,899 Q53L probably benign Het
Pxmp4 C A 2: 154,588,059 A137S possibly damaging Het
Rasef C T 4: 73,780,519 probably benign Het
Rsg1 T G 4: 141,217,288 V50G probably benign Het
Scrt2 C T 2: 152,093,143 A72V probably benign Het
Sipa1l2 T C 8: 125,450,362 E1171G possibly damaging Het
Slc26a8 T C 17: 28,638,401 T923A possibly damaging Het
Slco1a6 T C 6: 142,133,146 K141R probably benign Het
Slfn5 T A 11: 82,958,666 probably null Het
Sympk A T 7: 19,036,830 H282L probably damaging Het
Tnr A G 1: 159,924,107 Y1324C probably damaging Het
Topaz1 A G 9: 122,748,535 N170S possibly damaging Het
Trav6-3 T C 14: 53,428,762 M1T probably null Het
Trim66 A G 7: 109,475,879 S392P probably benign Het
Ttn T C 2: 76,768,811 T10958A probably damaging Het
Ubr7 A G 12: 102,768,235 K256R probably benign Het
Other mutations in Mtor
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01123:Mtor APN 4 148453037 missense probably benign 0.06
IGL01447:Mtor APN 4 148530757 missense possibly damaging 0.62
IGL01551:Mtor APN 4 148472037 missense probably damaging 0.99
IGL01661:Mtor APN 4 148514851 missense possibly damaging 0.61
IGL01675:Mtor APN 4 148484654 missense probably benign 0.00
IGL01743:Mtor APN 4 148530613 splice site probably benign
IGL02015:Mtor APN 4 148540113 nonsense probably null
IGL02084:Mtor APN 4 148470680 missense probably damaging 0.98
IGL02095:Mtor APN 4 148544541 missense probably damaging 1.00
IGL02129:Mtor APN 4 148549845 missense possibly damaging 0.91
IGL02260:Mtor APN 4 148538301 missense probably damaging 1.00
IGL02329:Mtor APN 4 148534939 missense probably benign 0.16
IGL02440:Mtor APN 4 148546429 missense probably benign 0.24
IGL02440:Mtor APN 4 148491647 missense probably benign 0.04
IGL02449:Mtor APN 4 148533921 missense possibly damaging 0.65
IGL02479:Mtor APN 4 148470584 missense probably damaging 1.00
IGL02904:Mtor APN 4 148452394 missense possibly damaging 0.55
IGL02904:Mtor APN 4 148491612 splice site probably benign
IGL02931:Mtor APN 4 148464964 missense probably benign 0.22
IGL03048:Mtor APN 4 148546390 splice site probably benign
IGL03133:Mtor APN 4 148484319 missense probably benign 0.01
IGL03142:Mtor APN 4 148453899 missense probably benign 0.00
dynamo UTSW 4 148462910 missense probably benign 0.00
engine UTSW 4 148556855 unclassified probably null
motor UTSW 4 148491360 missense possibly damaging 0.76
PIT4519001:Mtor UTSW 4 148524500 missense probably damaging 1.00
R0045:Mtor UTSW 4 148464949 missense probably benign 0.42
R0048:Mtor UTSW 4 148538881 nonsense probably null
R0048:Mtor UTSW 4 148538881 nonsense probably null
R0103:Mtor UTSW 4 148533902 missense probably benign 0.05
R0112:Mtor UTSW 4 148480923 missense probably damaging 1.00
R0137:Mtor UTSW 4 148470624 missense possibly damaging 0.78
R0184:Mtor UTSW 4 148464971 missense probably benign 0.05
R0208:Mtor UTSW 4 148464975 missense probably benign 0.43
R0329:Mtor UTSW 4 148484380 missense probably benign
R0330:Mtor UTSW 4 148484380 missense probably benign
R0365:Mtor UTSW 4 148486050 missense probably benign 0.01
R0537:Mtor UTSW 4 148538360 missense probably damaging 1.00
R0542:Mtor UTSW 4 148540450 missense probably benign 0.02
R0556:Mtor UTSW 4 148469380 missense possibly damaging 0.88
R0613:Mtor UTSW 4 148526046 missense possibly damaging 0.95
R0646:Mtor UTSW 4 148484354 nonsense probably null
R0710:Mtor UTSW 4 148464391 missense possibly damaging 0.73
R0791:Mtor UTSW 4 148462910 missense probably benign 0.00
R0792:Mtor UTSW 4 148462910 missense probably benign 0.00
R0866:Mtor UTSW 4 148486056 missense probably benign 0.04
R0973:Mtor UTSW 4 148550188 missense probably damaging 1.00
R1027:Mtor UTSW 4 148539999 missense probably benign 0.03
R1028:Mtor UTSW 4 148538830 missense possibly damaging 0.88
R1289:Mtor UTSW 4 148470307 missense probably benign 0.10
R1416:Mtor UTSW 4 148491414 nonsense probably null
R1465:Mtor UTSW 4 148525993 splice site probably benign
R1506:Mtor UTSW 4 148536505 splice site probably benign
R1624:Mtor UTSW 4 148547676 missense probably damaging 1.00
R1695:Mtor UTSW 4 148538907 missense probably benign 0.08
R1771:Mtor UTSW 4 148470624 missense possibly damaging 0.78
R1800:Mtor UTSW 4 148462892 missense probably benign 0.00
R1855:Mtor UTSW 4 148553089 missense probably benign 0.02
R1857:Mtor UTSW 4 148480879 missense probably damaging 1.00
R1867:Mtor UTSW 4 148454632 missense probably damaging 0.97
R1954:Mtor UTSW 4 148468273 missense probably damaging 1.00
R2054:Mtor UTSW 4 148462852 missense probably benign 0.05
R2054:Mtor UTSW 4 148466025 missense probably benign 0.00
R2099:Mtor UTSW 4 148550192 nonsense probably null
R2148:Mtor UTSW 4 148456012 missense possibly damaging 0.56
R2214:Mtor UTSW 4 148538870 missense probably benign 0.39
R2281:Mtor UTSW 4 148489555 missense probably benign 0.02
R2512:Mtor UTSW 4 148530491 missense possibly damaging 0.95
R2870:Mtor UTSW 4 148540030 missense probably benign 0.00
R2870:Mtor UTSW 4 148540030 missense probably benign 0.00
R2871:Mtor UTSW 4 148540030 missense probably benign 0.00
R2871:Mtor UTSW 4 148540030 missense probably benign 0.00
R2872:Mtor UTSW 4 148540030 missense probably benign 0.00
R2872:Mtor UTSW 4 148540030 missense probably benign 0.00
R2873:Mtor UTSW 4 148540030 missense probably benign 0.00
R4032:Mtor UTSW 4 148536752 missense probably benign 0.03
R4073:Mtor UTSW 4 148549375 missense probably damaging 0.99
R4273:Mtor UTSW 4 148550152 missense probably benign 0.21
R4611:Mtor UTSW 4 148486119 missense probably benign 0.03
R4858:Mtor UTSW 4 148454816 makesense probably null
R4942:Mtor UTSW 4 148472142 missense probably benign 0.03
R4967:Mtor UTSW 4 148491360 missense possibly damaging 0.76
R4995:Mtor UTSW 4 148525752 missense probably damaging 1.00
R5054:Mtor UTSW 4 148556855 unclassified probably null
R5215:Mtor UTSW 4 148453983 missense probably benign
R5249:Mtor UTSW 4 148463732 missense probably damaging 1.00
R5289:Mtor UTSW 4 148466092 missense possibly damaging 0.88
R5365:Mtor UTSW 4 148550130 missense probably damaging 0.99
R5498:Mtor UTSW 4 148540364 missense possibly damaging 0.71
R5514:Mtor UTSW 4 148546444 missense probably damaging 1.00
R5540:Mtor UTSW 4 148454708 missense probably benign 0.01
R5600:Mtor UTSW 4 148491470 missense probably damaging 1.00
R5615:Mtor UTSW 4 148538276 missense possibly damaging 0.95
R5632:Mtor UTSW 4 148469006 missense possibly damaging 0.94
R5641:Mtor UTSW 4 148546425 missense probably damaging 0.98
R5834:Mtor UTSW 4 148536536 missense possibly damaging 0.95
R5984:Mtor UTSW 4 148538827 missense probably benign 0.02
R6056:Mtor UTSW 4 148537435 missense probably benign 0.00
R6225:Mtor UTSW 4 148521337 missense probably benign 0.04
R6262:Mtor UTSW 4 148526095 missense possibly damaging 0.46
R6335:Mtor UTSW 4 148465927 missense probably damaging 1.00
R6479:Mtor UTSW 4 148551000 missense probably benign 0.16
R6711:Mtor UTSW 4 148452367 missense possibly damaging 0.49
R6715:Mtor UTSW 4 148538547 missense probably benign 0.00
R6744:Mtor UTSW 4 148458655 missense probably benign 0.01
R6748:Mtor UTSW 4 148550184 missense probably damaging 1.00
R6762:Mtor UTSW 4 148538481 missense possibly damaging 0.47
R6836:Mtor UTSW 4 148489498 missense possibly damaging 0.94
R6948:Mtor UTSW 4 148536752 missense probably benign 0.12
R6979:Mtor UTSW 4 148524473 missense possibly damaging 0.60
R6992:Mtor UTSW 4 148464475 missense probably benign
R7271:Mtor UTSW 4 148546485 missense possibly damaging 0.70
X0025:Mtor UTSW 4 148530714 missense probably benign 0.09
Predicted Primers PCR Primer
(F):5'- TGGGATGCCTTCTTCACAG -3'
(R):5'- CATTAAGCCTTCTTCCACAGTG -3'

Sequencing Primer
(F):5'- TCTTCACAGAGGGCCCCTTAG -3'
(R):5'- CCACAGTGATTTCCTCAGATAGC -3'
Posted On2018-06-06