Incidental Mutation 'R6519:Hdac2'
ID521014
Institutional Source Beutler Lab
Gene Symbol Hdac2
Ensembl Gene ENSMUSG00000019777
Gene Namehistone deacetylase 2
SynonymsYy1bp, D10Wsu179e
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6519 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location36974544-37001889 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 36989256 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 155 (N155K)
Ref Sequence ENSEMBL: ENSMUSP00000101149 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019911] [ENSMUST00000105510]
Predicted Effect probably damaging
Transcript: ENSMUST00000019911
AA Change: N155K

PolyPhen 2 Score 0.982 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000019911
Gene: ENSMUSG00000019777
AA Change: N155K

DomainStartEndE-ValueType
Pfam:Hist_deacetyl 19 321 2.5e-88 PFAM
low complexity region 392 403 N/A INTRINSIC
low complexity region 418 431 N/A INTRINSIC
low complexity region 448 469 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000105510
AA Change: N155K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000101149
Gene: ENSMUSG00000019777
AA Change: N155K

DomainStartEndE-ValueType
Pfam:Hist_deacetyl 19 297 8.9e-75 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128031
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.5%
  • 20x: 91.7%
Validation Efficiency 97% (58/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene product belongs to the histone deacetylase family. Histone deacetylases act via the formation of large multiprotein complexes, and are responsible for the deacetylation of lysine residues at the N-terminal regions of core histones (H2A, H2B, H3 and H4). This protein forms transcriptional repressor complexes by associating with many different proteins, including YY1, a mammalian zinc-finger transcription factor. Thus, it plays an important role in transcriptional regulation, cell cycle progression and developmental events. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2010]
PHENOTYPE: Mice homozygous for a null allele exhibit embryonic and postnatal lethality accompanied with a transient decrease in body size and increase in heart size and cardiomyocyte proliferation that is overcome by 2 months of age in surviving mice. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A4gnt T C 9: 99,613,670 I53T probably damaging Het
Adgrv1 C T 13: 81,567,343 D909N probably benign Het
Ahdc1 T C 4: 133,064,768 Y1107H possibly damaging Het
Aldob A T 4: 49,543,835 V49E probably damaging Het
Apol6 T A 15: 77,051,276 Y248* probably null Het
Apol7b T A 15: 77,423,348 T316S probably benign Het
Atp13a2 G C 4: 141,000,854 R503P possibly damaging Het
BC037034 A G 5: 138,261,848 S344P probably damaging Het
Brca2 A C 5: 150,540,979 T1403P probably damaging Het
Casc4 T C 2: 121,906,737 V141A probably benign Het
Cblc T C 7: 19,792,863 Y148C probably damaging Het
Cct7 C A 6: 85,462,150 Q149K probably benign Het
Cd53 T A 3: 106,762,145 H179L probably benign Het
Cyp2b19 A G 7: 26,759,111 T84A probably benign Het
Cyp3a41a A G 5: 145,715,498 C64R probably damaging Het
Dclre1c T C 2: 3,429,329 Y75H probably damaging Het
Dhx35 A T 2: 158,831,710 I354F probably damaging Het
Diaph3 T C 14: 86,966,335 N629S probably damaging Het
Dnase1 A T 16: 4,038,589 S132C probably damaging Het
Dnttip2 T C 3: 122,275,471 S112P probably benign Het
Eif4g3 C A 4: 137,994,008 P48T probably benign Het
Fat4 A T 3: 39,002,871 T4239S probably benign Het
Fbn2 A G 18: 58,063,575 V1419A possibly damaging Het
Ghitm A C 14: 37,125,247 M290R probably damaging Het
Glb1l T C 1: 75,201,056 D406G probably benign Het
Glipr1l1 C A 10: 112,062,248 A86D probably benign Het
Grm7 C T 6: 111,207,752 A348V probably benign Het
Gtf2h3 C T 5: 124,584,297 T121I probably benign Het
Hus1b A G 13: 30,946,947 I243T probably benign Het
Kcnab2 T C 4: 152,411,993 T65A probably damaging Het
Lasp1 T A 11: 97,815,557 probably null Het
Lrch3 G A 16: 32,994,997 probably benign Het
Ltb4r2 C T 14: 55,762,981 T353M probably benign Het
Macf1 A G 4: 123,472,325 M1316T probably benign Het
Msr1 G A 8: 39,624,221 T116I probably benign Het
Nlrp5 A G 7: 23,417,918 I356V probably benign Het
Npy C T 6: 49,823,689 S31F possibly damaging Het
Nsd3 C T 8: 25,662,939 P432S probably damaging Het
Nup160 A C 2: 90,718,217 R1037S probably damaging Het
Olfr284 C T 15: 98,340,048 G314R probably benign Het
Olfr32 A T 2: 90,138,812 I109N possibly damaging Het
Olfr533 T A 7: 140,466,545 S115T probably benign Het
Pcx A G 19: 4,602,211 E108G possibly damaging Het
Pecam1 A T 11: 106,699,642 M102K probably benign Het
Pgd G T 4: 149,150,886 Y433* probably null Het
Pkd1l3 A G 8: 109,628,772 E744G probably benign Het
Rb1 A G 14: 73,298,063 I118T probably benign Het
Rdh11 T A 12: 79,182,815 H228L probably damaging Het
Rnf44 C T 13: 54,681,786 R340Q probably damaging Het
Rtraf A G 14: 19,819,930 V88A possibly damaging Het
Sigmar1 T C 4: 41,739,380 T185A possibly damaging Het
Thsd1 A G 8: 22,259,065 R590G probably damaging Het
Trbv19 T C 6: 41,178,639 probably benign Het
Txnrd3 T C 6: 89,654,423 probably null Het
Wwc1 C T 11: 35,853,437 E853K probably benign Het
Xpnpep1 T C 19: 53,011,844 N192D possibly damaging Het
Zfp955b T A 17: 33,302,077 S173R possibly damaging Het
Zranb1 T A 7: 132,950,128 C195* probably null Het
Other mutations in Hdac2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00331:Hdac2 APN 10 36997071 missense probably damaging 1.00
IGL00827:Hdac2 APN 10 36997114 missense probably benign
IGL02971:Hdac2 APN 10 37000374 nonsense probably null
checkmate UTSW 10 36993899 missense probably benign
failure UTSW 10 36989184 missense probably benign 0.16
misstep UTSW 10 36986374 missense possibly damaging 0.59
R0123:Hdac2 UTSW 10 36989184 missense probably benign 0.16
R0134:Hdac2 UTSW 10 36989184 missense probably benign 0.16
R0167:Hdac2 UTSW 10 37000372 missense probably benign 0.04
R0225:Hdac2 UTSW 10 36989184 missense probably benign 0.16
R0455:Hdac2 UTSW 10 36991836 missense probably damaging 1.00
R0480:Hdac2 UTSW 10 36974792 missense probably damaging 1.00
R0482:Hdac2 UTSW 10 36989134 intron probably benign
R0535:Hdac2 UTSW 10 36993899 missense probably benign
R1101:Hdac2 UTSW 10 36991809 missense probably damaging 1.00
R1297:Hdac2 UTSW 10 36986374 missense possibly damaging 0.59
R4839:Hdac2 UTSW 10 36997466 missense probably benign 0.04
R6109:Hdac2 UTSW 10 36986389 missense probably null 0.83
R6447:Hdac2 UTSW 10 36993816 missense possibly damaging 0.95
R6893:Hdac2 UTSW 10 36997007 missense probably damaging 1.00
R7461:Hdac2 UTSW 10 36989236 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGCATATTTAATAGGGCTTCGC -3'
(R):5'- CACTGTAGTGGTCTATTTCTCACAC -3'

Sequencing Primer
(F):5'- ATAGGGCTTCGCTTATATGTATTTTG -3'
(R):5'- ACTTCTGCAGGGGCTCACAAC -3'
Posted On2018-06-06