Incidental Mutation 'R6545:Gria2'
ID521079
Institutional Source Beutler Lab
Gene Symbol Gria2
Ensembl Gene ENSMUSG00000033981
Gene Nameglutamate receptor, ionotropic, AMPA2 (alpha 2)
SynonymsGlur2, Glur-2, GluR-B, GluA2, GluR2
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.350) question?
Stock #R6545 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location80681450-80802835 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 80741144 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Arginine at position 95 (K95R)
Ref Sequence ENSEMBL: ENSMUSP00000141447 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075316] [ENSMUST00000107745] [ENSMUST00000192463]
Predicted Effect probably damaging
Transcript: ENSMUST00000075316
AA Change: K95R

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000074787
Gene: ENSMUSG00000033981
AA Change: K95R

DomainStartEndE-ValueType
Pfam:ANF_receptor 49 379 2.7e-58 PFAM
PBPe 415 790 3.75e-132 SMART
Lig_chan-Glu_bd 425 490 2.96e-31 SMART
low complexity region 820 832 N/A INTRINSIC
low complexity region 853 865 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000107745
AA Change: K95R

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000103374
Gene: ENSMUSG00000033981
AA Change: K95R

DomainStartEndE-ValueType
Pfam:ANF_receptor 47 379 4.8e-53 PFAM
PBPe 415 790 8.16e-133 SMART
Lig_chan-Glu_bd 425 490 2.96e-31 SMART
low complexity region 820 832 N/A INTRINSIC
low complexity region 853 865 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000192463
AA Change: K95R

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000141447
Gene: ENSMUSG00000033981
AA Change: K95R

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:ANF_receptor 47 379 1.7e-51 PFAM
PBPe 415 770 1.2e-105 SMART
Lig_chan-Glu_bd 425 490 2.2e-35 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193645
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194383
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194523
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195062
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.6%
Validation Efficiency 95% (42/44)
MGI Phenotype FUNCTION: Glutamate receptors are the predominant excitatory neurotransmitter receptors in the mammalian brain and are activated in a variety of normal neurophysiologic processes. This gene product belongs to a family of glutamate receptors that are sensitive to alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate (AMPA), and function as ligand-activated cation channels. These channels are assembled from 4 related subunits, Gria1-4. The subunit encoded by this gene (Gria2) is subject to RNA editing (CAG->CGG; Q->R) within the second transmembrane domain, which is thought to render the channel impermeable to Ca(2+). Alternative splicing, resulting in transcript variants encoding different isoforms, (including the flip and flop isoforms that vary in their signal transduction properties), has been noted for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations exhibit epilepsy, deficient dendritic architecture, altered exploratory behavior, impaired motor and learning performance, and increased mortality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ago1 C T 4: 126,454,352 A58T possibly damaging Het
Ago4 T A 4: 126,512,018 Q366L probably benign Het
Card10 C A 15: 78,776,810 G950V probably damaging Het
Ceacam1 A T 7: 25,473,854 V303D probably damaging Het
Cfap54 C T 10: 92,836,457 R2917H probably benign Het
Cit A G 5: 115,846,434 S22G probably null Het
Cog4 A G 8: 110,880,945 E666G probably damaging Het
Crocc2 A G 1: 93,212,937 D1103G probably benign Het
Cttnbp2 A T 6: 18,405,279 probably null Het
Dctn3 T C 4: 41,723,084 E16G probably damaging Het
Dnah6 A G 6: 73,044,732 S3536P probably damaging Het
Eef2 T A 10: 81,181,114 I675N probably damaging Het
Gga3 A G 11: 115,587,169 F531S possibly damaging Het
Gm19410 A G 8: 35,790,498 R697G possibly damaging Het
Gm3173 T A 14: 4,514,810 M18K possibly damaging Het
Gm35339 C T 15: 76,363,378 R1585C probably damaging Het
Gm5800 A T 14: 51,711,962 S175R possibly damaging Het
Gstm6 A G 3: 107,942,365 I76T probably damaging Het
Harbi1 T G 2: 91,712,295 Y34D probably damaging Het
Hectd2 C A 19: 36,587,378 Q20K probably benign Het
Inpp5f C A 7: 128,694,556 A250D possibly damaging Het
Irf9 T C 14: 55,605,227 F59L probably damaging Het
Itgam T A 7: 128,107,872 M625K probably damaging Het
Kcnh5 C T 12: 75,007,658 R504Q probably damaging Het
Lama2 T C 10: 27,176,797 T1389A probably benign Het
Lin54 T A 5: 100,485,137 probably null Het
Mettl23 A G 11: 116,849,216 D171G possibly damaging Het
Mgll A G 6: 88,825,703 N296S probably benign Het
Mpv17 T A 5: 31,144,697 probably benign Het
Myof A T 19: 37,942,297 M1001K possibly damaging Het
Myom1 A T 17: 71,082,305 Q850L probably benign Het
Olfr509 A T 7: 108,646,455 N40K probably damaging Het
Pias2 A G 18: 77,130,085 I328V possibly damaging Het
Polh G A 17: 46,182,759 P311S possibly damaging Het
Prss34 A T 17: 25,298,835 R61S probably benign Het
Rassf2 A T 2: 131,998,317 M280K probably damaging Het
Rpsa A G 9: 120,130,257 H47R probably benign Het
Rtp3 A G 9: 110,986,826 V219A possibly damaging Het
Smarcc2 T C 10: 128,484,128 I790T probably benign Het
Stag3 A G 5: 138,298,352 T491A possibly damaging Het
Svil C T 18: 5,108,621 H2007Y probably benign Het
Togaram1 T G 12: 64,978,207 C750G possibly damaging Het
Vmn2r13 A T 5: 109,156,940 probably null Het
Vmn2r4 A T 3: 64,406,356 D401E possibly damaging Het
Wsb1 A T 11: 79,251,055 D45E probably damaging Het
Zfp808 T A 13: 62,171,895 Y313N probably benign Het
Other mutations in Gria2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00796:Gria2 APN 3 80710790 missense probably benign 0.12
IGL00832:Gria2 APN 3 80707251 missense probably damaging 1.00
IGL01086:Gria2 APN 3 80692381 missense probably damaging 1.00
IGL01409:Gria2 APN 3 80707697 critical splice donor site probably null
IGL01924:Gria2 APN 3 80710331 missense probably benign 0.13
IGL01999:Gria2 APN 3 80732091 missense probably damaging 1.00
IGL02355:Gria2 APN 3 80706937 missense probably damaging 1.00
IGL02362:Gria2 APN 3 80706937 missense probably damaging 1.00
IGL02389:Gria2 APN 3 80709422 missense probably benign 0.14
IGL02444:Gria2 APN 3 80702553 missense possibly damaging 0.65
IGL02532:Gria2 APN 3 80706999 missense probably damaging 1.00
IGL02991:Gria2 UTSW 3 80707809 nonsense probably null
R0015:Gria2 UTSW 3 80707767 missense probably damaging 1.00
R0148:Gria2 UTSW 3 80707731 missense probably damaging 1.00
R0201:Gria2 UTSW 3 80707838 missense probably damaging 1.00
R0411:Gria2 UTSW 3 80710858 splice site probably benign
R0551:Gria2 UTSW 3 80732026 splice site probably benign
R0655:Gria2 UTSW 3 80732070 nonsense probably null
R0866:Gria2 UTSW 3 80722024 splice site probably benign
R1393:Gria2 UTSW 3 80707098 missense probably damaging 1.00
R1458:Gria2 UTSW 3 80732045 missense possibly damaging 0.71
R1563:Gria2 UTSW 3 80691397 missense probably damaging 0.96
R1771:Gria2 UTSW 3 80692301 nonsense probably null
R1775:Gria2 UTSW 3 80691338 missense probably benign 0.09
R1902:Gria2 UTSW 3 80722108 missense probably damaging 0.98
R1993:Gria2 UTSW 3 80802357 missense probably benign
R1994:Gria2 UTSW 3 80802357 missense probably benign
R1995:Gria2 UTSW 3 80802357 missense probably benign
R2001:Gria2 UTSW 3 80710805 missense probably benign 0.28
R2389:Gria2 UTSW 3 80702625 missense probably damaging 1.00
R2520:Gria2 UTSW 3 80706962 missense probably damaging 1.00
R2679:Gria2 UTSW 3 80740953 splice site probably benign
R2865:Gria2 UTSW 3 80732085 missense probably benign 0.00
R2869:Gria2 UTSW 3 80702492 missense probably damaging 1.00
R2869:Gria2 UTSW 3 80702492 missense probably damaging 1.00
R2870:Gria2 UTSW 3 80702492 missense probably damaging 1.00
R2870:Gria2 UTSW 3 80702492 missense probably damaging 1.00
R2871:Gria2 UTSW 3 80702492 missense probably damaging 1.00
R2871:Gria2 UTSW 3 80702492 missense probably damaging 1.00
R2872:Gria2 UTSW 3 80702492 missense probably damaging 1.00
R2872:Gria2 UTSW 3 80702492 missense probably damaging 1.00
R3716:Gria2 UTSW 3 80741004 missense possibly damaging 0.77
R3967:Gria2 UTSW 3 80710777 missense possibly damaging 0.95
R4285:Gria2 UTSW 3 80707662 intron probably benign
R4611:Gria2 UTSW 3 80692492 missense probably damaging 0.99
R4612:Gria2 UTSW 3 80732051 missense probably damaging 1.00
R4616:Gria2 UTSW 3 80706897 missense probably damaging 1.00
R4706:Gria2 UTSW 3 80740990 missense probably benign
R4996:Gria2 UTSW 3 80707141 missense probably damaging 0.99
R5502:Gria2 UTSW 3 80706945 missense probably damaging 1.00
R5930:Gria2 UTSW 3 80707249 missense possibly damaging 0.91
R6142:Gria2 UTSW 3 80801717 missense probably benign 0.13
R6233:Gria2 UTSW 3 80707203 missense probably damaging 0.99
R6317:Gria2 UTSW 3 80741004 missense possibly damaging 0.79
R6453:Gria2 UTSW 3 80740974 missense possibly damaging 0.93
R6526:Gria2 UTSW 3 80692469 missense probably damaging 1.00
R6574:Gria2 UTSW 3 80689296 missense probably damaging 0.99
R6720:Gria2 UTSW 3 80802304 missense probably benign 0.37
R7009:Gria2 UTSW 3 80706972 missense probably damaging 1.00
R7049:Gria2 UTSW 3 80689327 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GTCACTGTCATAGAGGTATGCG -3'
(R):5'- AATAATCTATGCCCTTCCTTGTAGC -3'

Sequencing Primer
(F):5'- GTCATAGAGGTATGCGAACTTATCCC -3'
(R):5'- TGAATTCATCAACCTGAATGCTAAG -3'
Posted On2018-06-06