Incidental Mutation 'R6545:Dctn3'
ID521083
Institutional Source Beutler Lab
Gene Symbol Dctn3
Ensembl Gene ENSMUSG00000028447
Gene Namedynactin 3
Synonymsp24
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.950) question?
Stock #R6545 (G1)
Quality Score215.009
Status Validated
Chromosome4
Chromosomal Location41714798-41723170 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 41723084 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 16 (E16G)
Ref Sequence ENSEMBL: ENSMUSP00000130988 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030158] [ENSMUST00000084698] [ENSMUST00000108041] [ENSMUST00000150809] [ENSMUST00000171251] [ENSMUST00000171641]
Predicted Effect possibly damaging
Transcript: ENSMUST00000030158
AA Change: E16G

PolyPhen 2 Score 0.807 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000030158
Gene: ENSMUSG00000028447
AA Change: E16G

DomainStartEndE-ValueType
Pfam:Dynactin_p22 6 170 2.8e-61 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000084698
SMART Domains Protein: ENSMUSP00000081748
Gene: ENSMUSG00000066224

DomainStartEndE-ValueType
low complexity region 3 14 N/A INTRINSIC
low complexity region 18 32 N/A INTRINSIC
low complexity region 41 71 N/A INTRINSIC
ARID 107 198 5.47e-35 SMART
BRIGHT 111 203 3.7e-39 SMART
low complexity region 235 257 N/A INTRINSIC
Blast:ARID 283 327 2e-12 BLAST
low complexity region 387 409 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108041
SMART Domains Protein: ENSMUSP00000103676
Gene: ENSMUSG00000073889

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
IG 33 108 5.75e-4 SMART
FN3 112 204 2.18e-2 SMART
FN3 218 304 4.93e-1 SMART
low complexity region 354 365 N/A INTRINSIC
transmembrane domain 369 391 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147120
Predicted Effect probably benign
Transcript: ENSMUST00000150809
SMART Domains Protein: ENSMUSP00000116411
Gene: ENSMUSG00000066224

DomainStartEndE-ValueType
low complexity region 3 14 N/A INTRINSIC
low complexity region 18 32 N/A INTRINSIC
low complexity region 41 71 N/A INTRINSIC
ARID 107 198 5.47e-35 SMART
BRIGHT 111 203 3.7e-39 SMART
low complexity region 235 257 N/A INTRINSIC
Blast:ARID 283 327 2e-12 BLAST
low complexity region 357 379 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000171251
SMART Domains Protein: ENSMUSP00000127678
Gene: ENSMUSG00000066224

DomainStartEndE-ValueType
low complexity region 3 14 N/A INTRINSIC
low complexity region 18 32 N/A INTRINSIC
low complexity region 41 71 N/A INTRINSIC
ARID 107 198 5.47e-35 SMART
BRIGHT 111 203 3.7e-39 SMART
low complexity region 235 257 N/A INTRINSIC
Blast:ARID 283 327 2e-12 BLAST
low complexity region 387 409 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000171641
AA Change: E16G

PolyPhen 2 Score 0.973 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000130988
Gene: ENSMUSG00000028447
AA Change: E16G

DomainStartEndE-ValueType
Pfam:Dynactin_p22 1 149 1.4e-63 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.6%
Validation Efficiency 95% (42/44)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the smallest subunit of dynactin, a macromolecular complex consisting of 10 subunits ranging in size from 22 to 150 kD. Dynactin binds to both microtubules and cytoplasmic dynein. It is involved in a diverse array of cellular functions, including ER-to-Golgi transport, the centripetal movement of lysosomes and endosomes, spindle formation, cytokinesis, chromosome movement, nuclear positioning, and axonogenesis. This subunit, like most other dynactin subunits, exists only as a part of the dynactin complex. It is primarily an alpha-helical protein with very little coiled coil, and binds directly to the largest subunit (p150) of dynactin. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2013]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ago1 C T 4: 126,454,352 A58T possibly damaging Het
Ago4 T A 4: 126,512,018 Q366L probably benign Het
Card10 C A 15: 78,776,810 G950V probably damaging Het
Ceacam1 A T 7: 25,473,854 V303D probably damaging Het
Cfap54 C T 10: 92,836,457 R2917H probably benign Het
Cit A G 5: 115,846,434 S22G probably null Het
Cog4 A G 8: 110,880,945 E666G probably damaging Het
Crocc2 A G 1: 93,212,937 D1103G probably benign Het
Cttnbp2 A T 6: 18,405,279 probably null Het
Dnah6 A G 6: 73,044,732 S3536P probably damaging Het
Eef2 T A 10: 81,181,114 I675N probably damaging Het
Gga3 A G 11: 115,587,169 F531S possibly damaging Het
Gm19410 A G 8: 35,790,498 R697G possibly damaging Het
Gm3173 T A 14: 4,514,810 M18K possibly damaging Het
Gm35339 C T 15: 76,363,378 R1585C probably damaging Het
Gm5800 A T 14: 51,711,962 S175R possibly damaging Het
Gria2 T C 3: 80,741,144 K95R probably damaging Het
Gstm6 A G 3: 107,942,365 I76T probably damaging Het
Harbi1 T G 2: 91,712,295 Y34D probably damaging Het
Hectd2 C A 19: 36,587,378 Q20K probably benign Het
Inpp5f C A 7: 128,694,556 A250D possibly damaging Het
Irf9 T C 14: 55,605,227 F59L probably damaging Het
Itgam T A 7: 128,107,872 M625K probably damaging Het
Kcnh5 C T 12: 75,007,658 R504Q probably damaging Het
Lama2 T C 10: 27,176,797 T1389A probably benign Het
Lin54 T A 5: 100,485,137 probably null Het
Mettl23 A G 11: 116,849,216 D171G possibly damaging Het
Mgll A G 6: 88,825,703 N296S probably benign Het
Mpv17 T A 5: 31,144,697 probably benign Het
Myof A T 19: 37,942,297 M1001K possibly damaging Het
Myom1 A T 17: 71,082,305 Q850L probably benign Het
Olfr509 A T 7: 108,646,455 N40K probably damaging Het
Pias2 A G 18: 77,130,085 I328V possibly damaging Het
Polh G A 17: 46,182,759 P311S possibly damaging Het
Prss34 A T 17: 25,298,835 R61S probably benign Het
Rassf2 A T 2: 131,998,317 M280K probably damaging Het
Rpsa A G 9: 120,130,257 H47R probably benign Het
Rtp3 A G 9: 110,986,826 V219A possibly damaging Het
Smarcc2 T C 10: 128,484,128 I790T probably benign Het
Stag3 A G 5: 138,298,352 T491A possibly damaging Het
Svil C T 18: 5,108,621 H2007Y probably benign Het
Togaram1 T G 12: 64,978,207 C750G possibly damaging Het
Vmn2r13 A T 5: 109,156,940 probably null Het
Vmn2r4 A T 3: 64,406,356 D401E possibly damaging Het
Wsb1 A T 11: 79,251,055 D45E probably damaging Het
Zfp808 T A 13: 62,171,895 Y313N probably benign Het
Other mutations in Dctn3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01462:Dctn3 APN 4 41719854 nonsense probably null
IGL03000:Dctn3 APN 4 41719912 missense possibly damaging 0.94
R1687:Dctn3 UTSW 4 41715407 missense probably damaging 1.00
R1835:Dctn3 UTSW 4 41720813 missense probably damaging 1.00
R2164:Dctn3 UTSW 4 41723065 nonsense probably null
R3427:Dctn3 UTSW 4 41719858 missense probably damaging 1.00
R4801:Dctn3 UTSW 4 41719904 nonsense probably null
R4802:Dctn3 UTSW 4 41719904 nonsense probably null
R5617:Dctn3 UTSW 4 41716407 missense possibly damaging 0.70
R5979:Dctn3 UTSW 4 41715393 splice site probably null
R6819:Dctn3 UTSW 4 41715259 missense possibly damaging 0.79
Predicted Primers PCR Primer
(F):5'- AAGGGTCCGATTGGTACCAG -3'
(R):5'- GTTATTTCCGACATCCAAAGCC -3'

Sequencing Primer
(F):5'- TTGTTATTTATTTCAGAGCCTGGGC -3'
(R):5'- AGCCTAAACAGTGACGTCAC -3'
Posted On2018-06-06