Incidental Mutation 'R6545:Ago4'
ID521087
Institutional Source Beutler Lab
Gene Symbol Ago4
Ensembl Gene ENSMUSG00000042500
Gene Nameargonaute RISC catalytic subunit 4
Synonymsargonaute 4, Eif2c4, 5730550L01Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.488) question?
Stock #R6545 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location126489541-126533472 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 126512018 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Leucine at position 366 (Q366L)
Ref Sequence ENSEMBL: ENSMUSP00000081312 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084289]
Predicted Effect probably benign
Transcript: ENSMUST00000084289
AA Change: Q366L

PolyPhen 2 Score 0.104 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000081312
Gene: ENSMUSG00000042500
AA Change: Q366L

DomainStartEndE-ValueType
Pfam:ArgoN 18 156 3.9e-28 PFAM
DUF1785 165 217 4.22e-24 SMART
PAZ 225 360 1.26e-3 SMART
Pfam:ArgoL2 365 412 1.2e-16 PFAM
Pfam:ArgoMid 421 503 8.6e-35 PFAM
Piwi 509 820 2.9e-130 SMART
Blast:Piwi 827 856 2e-9 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000122951
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.6%
Validation Efficiency 95% (42/44)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Argonaute family of proteins which contain PAZ and PIWI domains and play an integral role in RNA interference and short-interfering-RNA-mediated gene silencing. This gene is located on chromosome 1 in a cluster of related family members. [provided by RefSeq, Mar 2017]
PHENOTYPE: Male mice homozygous for a null mutation display oligozoospermia, decreased testis weight, premature entry into meiosis and disruption of sex body formation. However both males and females are fertile. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ago1 C T 4: 126,454,352 A58T possibly damaging Het
Card10 C A 15: 78,776,810 G950V probably damaging Het
Ceacam1 A T 7: 25,473,854 V303D probably damaging Het
Cfap54 C T 10: 92,836,457 R2917H probably benign Het
Cit A G 5: 115,846,434 S22G probably null Het
Cog4 A G 8: 110,880,945 E666G probably damaging Het
Crocc2 A G 1: 93,212,937 D1103G probably benign Het
Cttnbp2 A T 6: 18,405,279 probably null Het
Dctn3 T C 4: 41,723,084 E16G probably damaging Het
Dnah6 A G 6: 73,044,732 S3536P probably damaging Het
Eef2 T A 10: 81,181,114 I675N probably damaging Het
Gga3 A G 11: 115,587,169 F531S possibly damaging Het
Gm19410 A G 8: 35,790,498 R697G possibly damaging Het
Gm3173 T A 14: 4,514,810 M18K possibly damaging Het
Gm35339 C T 15: 76,363,378 R1585C probably damaging Het
Gm5800 A T 14: 51,711,962 S175R possibly damaging Het
Gria2 T C 3: 80,741,144 K95R probably damaging Het
Gstm6 A G 3: 107,942,365 I76T probably damaging Het
Harbi1 T G 2: 91,712,295 Y34D probably damaging Het
Hectd2 C A 19: 36,587,378 Q20K probably benign Het
Inpp5f C A 7: 128,694,556 A250D possibly damaging Het
Irf9 T C 14: 55,605,227 F59L probably damaging Het
Itgam T A 7: 128,107,872 M625K probably damaging Het
Kcnh5 C T 12: 75,007,658 R504Q probably damaging Het
Lama2 T C 10: 27,176,797 T1389A probably benign Het
Lin54 T A 5: 100,485,137 probably null Het
Mettl23 A G 11: 116,849,216 D171G possibly damaging Het
Mgll A G 6: 88,825,703 N296S probably benign Het
Mpv17 T A 5: 31,144,697 probably benign Het
Myof A T 19: 37,942,297 M1001K possibly damaging Het
Myom1 A T 17: 71,082,305 Q850L probably benign Het
Olfr509 A T 7: 108,646,455 N40K probably damaging Het
Pias2 A G 18: 77,130,085 I328V possibly damaging Het
Polh G A 17: 46,182,759 P311S possibly damaging Het
Prss34 A T 17: 25,298,835 R61S probably benign Het
Rassf2 A T 2: 131,998,317 M280K probably damaging Het
Rpsa A G 9: 120,130,257 H47R probably benign Het
Rtp3 A G 9: 110,986,826 V219A possibly damaging Het
Smarcc2 T C 10: 128,484,128 I790T probably benign Het
Stag3 A G 5: 138,298,352 T491A possibly damaging Het
Svil C T 18: 5,108,621 H2007Y probably benign Het
Togaram1 T G 12: 64,978,207 C750G possibly damaging Het
Vmn2r13 A T 5: 109,156,940 probably null Het
Vmn2r4 A T 3: 64,406,356 D401E possibly damaging Het
Wsb1 A T 11: 79,251,055 D45E probably damaging Het
Zfp808 T A 13: 62,171,895 Y313N probably benign Het
Other mutations in Ago4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00957:Ago4 APN 4 126517133 missense probably benign 0.01
IGL00965:Ago4 APN 4 126493314 missense probably benign 0.01
IGL01306:Ago4 APN 4 126515884 splice site probably null
IGL01943:Ago4 APN 4 126517195 missense probably damaging 1.00
IGL02079:Ago4 APN 4 126517084 missense probably damaging 0.99
IGL02117:Ago4 APN 4 126516852 missense probably benign 0.00
IGL02229:Ago4 APN 4 126511532 missense probably benign 0.34
IGL02503:Ago4 APN 4 126496805 nonsense probably null
IGL02504:Ago4 APN 4 126517439 missense probably benign 0.00
IGL02975:Ago4 APN 4 126512519 critical splice donor site probably null
IGL02837:Ago4 UTSW 4 126497300 missense possibly damaging 0.73
R0129:Ago4 UTSW 4 126517183 missense possibly damaging 0.85
R0142:Ago4 UTSW 4 126516932 missense probably benign 0.24
R0480:Ago4 UTSW 4 126526077 missense probably benign 0.00
R0533:Ago4 UTSW 4 126516860 missense probably benign 0.00
R1014:Ago4 UTSW 4 126506785 missense probably damaging 1.00
R1350:Ago4 UTSW 4 126507132 missense probably benign 0.04
R1547:Ago4 UTSW 4 126511413 missense probably benign 0.01
R1894:Ago4 UTSW 4 126512600 missense probably benign 0.11
R1900:Ago4 UTSW 4 126516936 missense probably benign 0.00
R2510:Ago4 UTSW 4 126517071 missense probably damaging 1.00
R2511:Ago4 UTSW 4 126517071 missense probably damaging 1.00
R4063:Ago4 UTSW 4 126515862 intron probably benign
R4064:Ago4 UTSW 4 126515862 intron probably benign
R4120:Ago4 UTSW 4 126496807 missense probably damaging 1.00
R4916:Ago4 UTSW 4 126506842 missense probably damaging 1.00
R4917:Ago4 UTSW 4 126506842 missense probably damaging 1.00
R4918:Ago4 UTSW 4 126506842 missense probably damaging 1.00
R4941:Ago4 UTSW 4 126526054 missense probably benign 0.00
R5169:Ago4 UTSW 4 126511727 missense probably benign 0.06
R5262:Ago4 UTSW 4 126496764 missense possibly damaging 0.66
R5385:Ago4 UTSW 4 126517556 missense probably benign
R5757:Ago4 UTSW 4 126526084 missense probably damaging 1.00
R6244:Ago4 UTSW 4 126511487 missense possibly damaging 0.67
R6256:Ago4 UTSW 4 126520226 missense probably damaging 1.00
R6389:Ago4 UTSW 4 126507244 missense probably damaging 1.00
X0062:Ago4 UTSW 4 126515941 missense probably benign 0.00
X0064:Ago4 UTSW 4 126517482 missense possibly damaging 0.87
Predicted Primers PCR Primer
(F):5'- AGCTCTGTCATCTCGTTGTG -3'
(R):5'- GTTCCTGGAAATAGACAAAGACTTC -3'

Sequencing Primer
(F):5'- CCAAATTCCTTCAGGTATGGGTCAG -3'
(R):5'- GACTTCATGTATAGAAGCCCATTTC -3'
Posted On2018-06-06