Incidental Mutation 'R6545:Mpv17'
ID521089
Institutional Source Beutler Lab
Gene Symbol Mpv17
Ensembl Gene ENSMUSG00000107283
Gene NameMpV17 mitochondrial inner membrane protein
SynonymsTg.Mpv17
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.092) question?
Stock #R6545 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location31140654-31154251 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to A at 31144697 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000144119 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000154241] [ENSMUST00000200744] [ENSMUST00000200833] [ENSMUST00000200864] [ENSMUST00000201353] [ENSMUST00000201491] [ENSMUST00000202241]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136581
Predicted Effect probably benign
Transcript: ENSMUST00000154241
SMART Domains Protein: ENSMUSP00000115292
Gene: ENSMUSG00000107283

DomainStartEndE-ValueType
transmembrane domain 48 70 N/A INTRINSIC
Pfam:Mpv17_PMP22 108 175 2.2e-28 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000200744
SMART Domains Protein: ENSMUSP00000143843
Gene: ENSMUSG00000107283

DomainStartEndE-ValueType
transmembrane domain 48 70 N/A INTRINSIC
Pfam:Mpv17_PMP22 103 163 5.7e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000200833
SMART Domains Protein: ENSMUSP00000144324
Gene: ENSMUSG00000107283

DomainStartEndE-ValueType
transmembrane domain 48 70 N/A INTRINSIC
transmembrane domain 94 116 N/A INTRINSIC
low complexity region 135 146 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000200864
SMART Domains Protein: ENSMUSP00000144331
Gene: ENSMUSG00000107283

DomainStartEndE-ValueType
transmembrane domain 48 70 N/A INTRINSIC
Pfam:Mpv17_PMP22 109 174 1.7e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000201171
Predicted Effect probably benign
Transcript: ENSMUST00000201353
SMART Domains Protein: ENSMUSP00000144198
Gene: ENSMUSG00000107283

DomainStartEndE-ValueType
transmembrane domain 48 70 N/A INTRINSIC
Pfam:Mpv17_PMP22 109 174 1.7e-27 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000201491
AA Change: Y155F
SMART Domains Protein: ENSMUSP00000144593
Gene: ENSMUSG00000107283
AA Change: Y155F

DomainStartEndE-ValueType
transmembrane domain 48 70 N/A INTRINSIC
Pfam:Mpv17_PMP22 109 155 4.6e-18 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202203
Predicted Effect probably benign
Transcript: ENSMUST00000202241
SMART Domains Protein: ENSMUSP00000144119
Gene: ENSMUSG00000107283

DomainStartEndE-ValueType
transmembrane domain 48 70 N/A INTRINSIC
Pfam:Mpv17_PMP22 109 176 4e-26 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202375
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202614
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202836
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.6%
Validation Efficiency 95% (42/44)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a mitochondrial inner membrane protein that is implicated in the metabolism of reactive oxygen species. Mutations in this gene have been associated with the hepatocerebral form of mitochondrial DNA depletion syndrome (MDDS). [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for mutations in this gene develop symptoms of kidney failure similar to focal segmental glomerulosclerosis due to depletion of mitochondrial content. Inner ear degeneration is also seen. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ago1 C T 4: 126,454,352 A58T possibly damaging Het
Ago4 T A 4: 126,512,018 Q366L probably benign Het
Card10 C A 15: 78,776,810 G950V probably damaging Het
Ceacam1 A T 7: 25,473,854 V303D probably damaging Het
Cfap54 C T 10: 92,836,457 R2917H probably benign Het
Cit A G 5: 115,846,434 S22G probably null Het
Cog4 A G 8: 110,880,945 E666G probably damaging Het
Crocc2 A G 1: 93,212,937 D1103G probably benign Het
Cttnbp2 A T 6: 18,405,279 probably null Het
Dctn3 T C 4: 41,723,084 E16G probably damaging Het
Dnah6 A G 6: 73,044,732 S3536P probably damaging Het
Eef2 T A 10: 81,181,114 I675N probably damaging Het
Gga3 A G 11: 115,587,169 F531S possibly damaging Het
Gm19410 A G 8: 35,790,498 R697G possibly damaging Het
Gm3173 T A 14: 4,514,810 M18K possibly damaging Het
Gm35339 C T 15: 76,363,378 R1585C probably damaging Het
Gm5800 A T 14: 51,711,962 S175R possibly damaging Het
Gria2 T C 3: 80,741,144 K95R probably damaging Het
Gstm6 A G 3: 107,942,365 I76T probably damaging Het
Harbi1 T G 2: 91,712,295 Y34D probably damaging Het
Hectd2 C A 19: 36,587,378 Q20K probably benign Het
Inpp5f C A 7: 128,694,556 A250D possibly damaging Het
Irf9 T C 14: 55,605,227 F59L probably damaging Het
Itgam T A 7: 128,107,872 M625K probably damaging Het
Kcnh5 C T 12: 75,007,658 R504Q probably damaging Het
Lama2 T C 10: 27,176,797 T1389A probably benign Het
Lin54 T A 5: 100,485,137 probably null Het
Mettl23 A G 11: 116,849,216 D171G possibly damaging Het
Mgll A G 6: 88,825,703 N296S probably benign Het
Myof A T 19: 37,942,297 M1001K possibly damaging Het
Myom1 A T 17: 71,082,305 Q850L probably benign Het
Olfr509 A T 7: 108,646,455 N40K probably damaging Het
Pias2 A G 18: 77,130,085 I328V possibly damaging Het
Polh G A 17: 46,182,759 P311S possibly damaging Het
Prss34 A T 17: 25,298,835 R61S probably benign Het
Rassf2 A T 2: 131,998,317 M280K probably damaging Het
Rpsa A G 9: 120,130,257 H47R probably benign Het
Rtp3 A G 9: 110,986,826 V219A possibly damaging Het
Smarcc2 T C 10: 128,484,128 I790T probably benign Het
Stag3 A G 5: 138,298,352 T491A possibly damaging Het
Svil C T 18: 5,108,621 H2007Y probably benign Het
Togaram1 T G 12: 64,978,207 C750G possibly damaging Het
Vmn2r13 A T 5: 109,156,940 probably null Het
Vmn2r4 A T 3: 64,406,356 D401E possibly damaging Het
Wsb1 A T 11: 79,251,055 D45E probably damaging Het
Zfp808 T A 13: 62,171,895 Y313N probably benign Het
Other mutations in Mpv17
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1672:Mpv17 UTSW 5 31153719 missense probably damaging 1.00
R2144:Mpv17 UTSW 5 31154189 critical splice donor site probably null
R4755:Mpv17 UTSW 5 31145982 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TTTGTGGGAGCAGAAGCCTC -3'
(R):5'- ACTTTCTCATTGCCTGCAGGG -3'

Sequencing Primer
(F):5'- CAGTGACACTCTAAGATGGTGTCC -3'
(R):5'- TTGCCTGCAGGGAAGCAC -3'
Posted On2018-06-06