Incidental Mutation 'R6545:Mgll'
ID521100
Institutional Source Beutler Lab
Gene Symbol Mgll
Ensembl Gene ENSMUSG00000033174
Gene Namemonoglyceride lipase
SynonymsMagl
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.160) question?
Stock #R6545 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location88724412-88828360 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 88825703 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 296 (N296S)
Ref Sequence ENSEMBL: ENSMUSP00000127374 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000089449] [ENSMUST00000113581] [ENSMUST00000113582] [ENSMUST00000113585] [ENSMUST00000163271] [ENSMUST00000203608] [ENSMUST00000203824]
Predicted Effect probably benign
Transcript: ENSMUST00000089449
AA Change: N280S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000086872
Gene: ENSMUSG00000033174
AA Change: N280S

DomainStartEndE-ValueType
Pfam:Hydrolase_4 27 105 6e-29 PFAM
Pfam:Abhydrolase_5 43 270 1e-21 PFAM
Pfam:Abhydrolase_6 44 282 4.4e-26 PFAM
Pfam:DUF2305 55 186 1.7e-7 PFAM
Pfam:Lipase_3 56 163 1.6e-9 PFAM
Pfam:Abhydrolase_1 71 284 4.2e-14 PFAM
Pfam:Esterase 82 195 8.6e-8 PFAM
Pfam:Abhydrolase_3 88 273 8.8e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113581
AA Change: N308S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000109211
Gene: ENSMUSG00000033174
AA Change: N308S

DomainStartEndE-ValueType
Pfam:Hydrolase_4 39 304 6.8e-70 PFAM
Pfam:Abhydrolase_5 43 298 1.1e-20 PFAM
Pfam:Abhydrolase_1 44 186 8.1e-13 PFAM
Pfam:Abhydrolase_6 44 310 4.4e-15 PFAM
Pfam:DUF2305 55 224 2.2e-8 PFAM
Pfam:Lipase_3 58 146 1.4e-8 PFAM
Pfam:Esterase 82 195 1.7e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113582
AA Change: N235S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000109212
Gene: ENSMUSG00000033174
AA Change: N235S

DomainStartEndE-ValueType
Pfam:Hydrolase_4 27 105 4.4e-29 PFAM
Pfam:Abhydrolase_5 43 225 3.2e-18 PFAM
Pfam:Abhydrolase_6 44 184 1.3e-18 PFAM
Pfam:Lipase_3 55 163 1.2e-9 PFAM
Pfam:DUF2305 55 249 4.9e-8 PFAM
Pfam:Abhydrolase_1 71 220 1.1e-13 PFAM
Pfam:Esterase 81 222 4.8e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113585
AA Change: N280S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000109215
Gene: ENSMUSG00000033174
AA Change: N280S

DomainStartEndE-ValueType
Pfam:Hydrolase_4 27 105 6e-29 PFAM
Pfam:Abhydrolase_5 43 270 1e-21 PFAM
Pfam:Abhydrolase_6 44 282 4.4e-26 PFAM
Pfam:DUF2305 55 186 1.7e-7 PFAM
Pfam:Lipase_3 56 163 1.6e-9 PFAM
Pfam:Abhydrolase_1 71 284 4.2e-14 PFAM
Pfam:Esterase 82 195 8.6e-8 PFAM
Pfam:Abhydrolase_3 88 273 8.8e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000163271
AA Change: N296S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000127374
Gene: ENSMUSG00000033174
AA Change: N296S

DomainStartEndE-ValueType
Pfam:Hydrolase_4 43 121 3e-28 PFAM
Pfam:Abhydrolase_5 59 286 3.9e-21 PFAM
Pfam:Abhydrolase_6 60 298 1.1e-25 PFAM
Pfam:DUF2305 71 202 1.3e-7 PFAM
Pfam:Lipase_3 72 179 2.6e-9 PFAM
Pfam:Abhydrolase_1 87 300 1.1e-13 PFAM
Pfam:Esterase 98 211 2e-7 PFAM
Pfam:Abhydrolase_3 104 289 8.7e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000203608
Predicted Effect probably benign
Transcript: ENSMUST00000203824
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205045
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.6%
Validation Efficiency 95% (42/44)
MGI Phenotype FUNCTION: This gene encodes a monoglyceride lipase, which catalyzes the hydrolysis of monoglycerides into fatty acids and glycerol. This enzyme is also thought to hydrolyze the endocannabinoid 2-arachidonoylglycerol. Alternatively spliced transcript variants have been described. [provided by RefSeq, Oct 2009]
PHENOTYPE: Mice homozygous for a gene trapped allele exhibit hypoalgesia, increased body temperature, and decreased fatty acid levels. Mice homozygous for a targeted allele exhibit impaired lipolysis and improved glucose homeostasis on a high-fat diet. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ago1 C T 4: 126,454,352 A58T possibly damaging Het
Ago4 T A 4: 126,512,018 Q366L probably benign Het
Card10 C A 15: 78,776,810 G950V probably damaging Het
Ceacam1 A T 7: 25,473,854 V303D probably damaging Het
Cfap54 C T 10: 92,836,457 R2917H probably benign Het
Cit A G 5: 115,846,434 S22G probably null Het
Cog4 A G 8: 110,880,945 E666G probably damaging Het
Crocc2 A G 1: 93,212,937 D1103G probably benign Het
Cttnbp2 A T 6: 18,405,279 probably null Het
Dctn3 T C 4: 41,723,084 E16G probably damaging Het
Dnah6 A G 6: 73,044,732 S3536P probably damaging Het
Eef2 T A 10: 81,181,114 I675N probably damaging Het
Gga3 A G 11: 115,587,169 F531S possibly damaging Het
Gm19410 A G 8: 35,790,498 R697G possibly damaging Het
Gm3173 T A 14: 4,514,810 M18K possibly damaging Het
Gm35339 C T 15: 76,363,378 R1585C probably damaging Het
Gm5800 A T 14: 51,711,962 S175R possibly damaging Het
Gria2 T C 3: 80,741,144 K95R probably damaging Het
Gstm6 A G 3: 107,942,365 I76T probably damaging Het
Harbi1 T G 2: 91,712,295 Y34D probably damaging Het
Hectd2 C A 19: 36,587,378 Q20K probably benign Het
Inpp5f C A 7: 128,694,556 A250D possibly damaging Het
Irf9 T C 14: 55,605,227 F59L probably damaging Het
Itgam T A 7: 128,107,872 M625K probably damaging Het
Kcnh5 C T 12: 75,007,658 R504Q probably damaging Het
Lama2 T C 10: 27,176,797 T1389A probably benign Het
Lin54 T A 5: 100,485,137 probably null Het
Mettl23 A G 11: 116,849,216 D171G possibly damaging Het
Mpv17 T A 5: 31,144,697 probably benign Het
Myof A T 19: 37,942,297 M1001K possibly damaging Het
Myom1 A T 17: 71,082,305 Q850L probably benign Het
Olfr509 A T 7: 108,646,455 N40K probably damaging Het
Pias2 A G 18: 77,130,085 I328V possibly damaging Het
Polh G A 17: 46,182,759 P311S possibly damaging Het
Prss34 A T 17: 25,298,835 R61S probably benign Het
Rassf2 A T 2: 131,998,317 M280K probably damaging Het
Rpsa A G 9: 120,130,257 H47R probably benign Het
Rtp3 A G 9: 110,986,826 V219A possibly damaging Het
Smarcc2 T C 10: 128,484,128 I790T probably benign Het
Stag3 A G 5: 138,298,352 T491A possibly damaging Het
Svil C T 18: 5,108,621 H2007Y probably benign Het
Togaram1 T G 12: 64,978,207 C750G possibly damaging Het
Vmn2r13 A T 5: 109,156,940 probably null Het
Vmn2r4 A T 3: 64,406,356 D401E possibly damaging Het
Wsb1 A T 11: 79,251,055 D45E probably damaging Het
Zfp808 T A 13: 62,171,895 Y313N probably benign Het
Other mutations in Mgll
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03182:Mgll APN 6 88823191 missense probably damaging 1.00
PIT4677001:Mgll UTSW 6 88825681 missense possibly damaging 0.96
R0624:Mgll UTSW 6 88725817 missense probably damaging 0.98
R1550:Mgll UTSW 6 88813889 missense probably benign 0.00
R1779:Mgll UTSW 6 88813948 nonsense probably null
R2230:Mgll UTSW 6 88825732 missense possibly damaging 0.65
R3712:Mgll UTSW 6 88764588 intron probably benign
R4751:Mgll UTSW 6 88725111 utr 5 prime probably benign
R5030:Mgll UTSW 6 88818665 critical splice donor site probably null
R5216:Mgll UTSW 6 88766329 nonsense probably null
R5523:Mgll UTSW 6 88725761 missense probably benign 0.04
R7251:Mgll UTSW 6 88823375 missense probably benign 0.17
Predicted Primers PCR Primer
(F):5'- ATACCTTCTCAGCTGCCAGG -3'
(R):5'- GCACTAGGGTACTAAGGGTTC -3'

Sequencing Primer
(F):5'- CGTCCCATCTAAAAATGAAGTAGG -3'
(R):5'- CATGTTCAGGGTGGACA -3'
Posted On2018-06-06