Incidental Mutation 'R6545:Ceacam1'
ID521102
Institutional Source Beutler Lab
Gene Symbol Ceacam1
Ensembl Gene ENSMUSG00000074272
Gene Namecarcinoembryonic antigen-related cell adhesion molecule 1
SynonymsCea1, C-CAM, Cc1, Hv2, CD66a, Cea-7, Cea7, Mhv-1, Hv-2, MHVR1, mmCGM1, mCEA1, Bgp1, mmCGM2, Bgp, Cea-1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.159) question?
Stock #R6545 (G1)
Quality Score99.0078
Status Not validated
Chromosome7
Chromosomal Location25461707-25477603 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 25473854 bp
ZygosityHeterozygous
Amino Acid Change Valine to Aspartic acid at position 303 (V303D)
Ref Sequence ENSEMBL: ENSMUSP00000145584 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098666] [ENSMUST00000098668] [ENSMUST00000098669] [ENSMUST00000205308] [ENSMUST00000206171] [ENSMUST00000206583] [ENSMUST00000206676] [ENSMUST00000206687]
Predicted Effect probably damaging
Transcript: ENSMUST00000098666
AA Change: V303D

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000096263
Gene: ENSMUSG00000074272
AA Change: V303D

DomainStartEndE-ValueType
Pfam:V-set 18 140 1e-21 PFAM
IGc2 158 224 1.61e-7 SMART
IGc2 252 308 5.04e-9 SMART
IGc2 337 401 8.37e-15 SMART
transmembrane domain 426 448 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000098668
SMART Domains Protein: ENSMUSP00000096265
Gene: ENSMUSG00000074272

DomainStartEndE-ValueType
Pfam:V-set 12 140 2.4e-21 PFAM
IGc2 157 221 8.37e-15 SMART
transmembrane domain 246 268 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000098669
AA Change: V303D

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000096266
Gene: ENSMUSG00000074272
AA Change: V303D

DomainStartEndE-ValueType
signal peptide 1 34 N/A INTRINSIC
Pfam:V-set 39 141 3.6e-13 PFAM
IGc2 158 224 1.61e-7 SMART
IGc2 252 308 5.04e-9 SMART
IGc2 337 401 8.37e-15 SMART
transmembrane domain 426 448 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000205308
Predicted Effect probably damaging
Transcript: ENSMUST00000206171
AA Change: V303D

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206300
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206483
Predicted Effect probably benign
Transcript: ENSMUST00000206583
Predicted Effect probably damaging
Transcript: ENSMUST00000206676
AA Change: V303D

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
Predicted Effect probably benign
Transcript: ENSMUST00000206687
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206717
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206981
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.6%
Validation Efficiency 95% (42/44)
MGI Phenotype PHENOTYPE: Mice lacking appreciable levels of the two isoforms containing 4 Ig domains and having increased levels of the two isoforms containing 2 Ig domains are viable and fertile. They are significantly more resistant to mouse hepatitis virus than wild-type mice. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ago1 C T 4: 126,454,352 A58T possibly damaging Het
Ago4 T A 4: 126,512,018 Q366L probably benign Het
Card10 C A 15: 78,776,810 G950V probably damaging Het
Cfap54 C T 10: 92,836,457 R2917H probably benign Het
Cit A G 5: 115,846,434 S22G probably null Het
Cog4 A G 8: 110,880,945 E666G probably damaging Het
Crocc2 A G 1: 93,212,937 D1103G probably benign Het
Cttnbp2 A T 6: 18,405,279 probably null Het
Dctn3 T C 4: 41,723,084 E16G probably damaging Het
Dnah6 A G 6: 73,044,732 S3536P probably damaging Het
Eef2 T A 10: 81,181,114 I675N probably damaging Het
Gga3 A G 11: 115,587,169 F531S possibly damaging Het
Gm19410 A G 8: 35,790,498 R697G possibly damaging Het
Gm3173 T A 14: 4,514,810 M18K possibly damaging Het
Gm35339 C T 15: 76,363,378 R1585C probably damaging Het
Gm5800 A T 14: 51,711,962 S175R possibly damaging Het
Gria2 T C 3: 80,741,144 K95R probably damaging Het
Gstm6 A G 3: 107,942,365 I76T probably damaging Het
Harbi1 T G 2: 91,712,295 Y34D probably damaging Het
Hectd2 C A 19: 36,587,378 Q20K probably benign Het
Inpp5f C A 7: 128,694,556 A250D possibly damaging Het
Irf9 T C 14: 55,605,227 F59L probably damaging Het
Itgam T A 7: 128,107,872 M625K probably damaging Het
Kcnh5 C T 12: 75,007,658 R504Q probably damaging Het
Lama2 T C 10: 27,176,797 T1389A probably benign Het
Lin54 T A 5: 100,485,137 probably null Het
Mettl23 A G 11: 116,849,216 D171G possibly damaging Het
Mgll A G 6: 88,825,703 N296S probably benign Het
Mpv17 T A 5: 31,144,697 probably benign Het
Myof A T 19: 37,942,297 M1001K possibly damaging Het
Myom1 A T 17: 71,082,305 Q850L probably benign Het
Olfr509 A T 7: 108,646,455 N40K probably damaging Het
Pias2 A G 18: 77,130,085 I328V possibly damaging Het
Polh G A 17: 46,182,759 P311S possibly damaging Het
Prss34 A T 17: 25,298,835 R61S probably benign Het
Rassf2 A T 2: 131,998,317 M280K probably damaging Het
Rpsa A G 9: 120,130,257 H47R probably benign Het
Rtp3 A G 9: 110,986,826 V219A possibly damaging Het
Smarcc2 T C 10: 128,484,128 I790T probably benign Het
Stag3 A G 5: 138,298,352 T491A possibly damaging Het
Svil C T 18: 5,108,621 H2007Y probably benign Het
Togaram1 T G 12: 64,978,207 C750G possibly damaging Het
Vmn2r13 A T 5: 109,156,940 probably null Het
Vmn2r4 A T 3: 64,406,356 D401E possibly damaging Het
Wsb1 A T 11: 79,251,055 D45E probably damaging Het
Zfp808 T A 13: 62,171,895 Y313N probably benign Het
Other mutations in Ceacam1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00701:Ceacam1 APN 7 25471914 missense possibly damaging 0.86
IGL01766:Ceacam1 APN 7 25471995 missense probably damaging 1.00
IGL02094:Ceacam1 APN 7 25474543 missense probably damaging 1.00
IGL02869:Ceacam1 APN 7 25476541 missense probably benign 0.07
IGL03325:Ceacam1 APN 7 25476487 missense possibly damaging 0.83
PIT4445001:Ceacam1 UTSW 7 25476456 missense probably damaging 1.00
PIT4810001:Ceacam1 UTSW 7 25471975 missense probably damaging 1.00
R0464:Ceacam1 UTSW 7 25472017 missense possibly damaging 0.64
R1270:Ceacam1 UTSW 7 25466314 splice site probably null
R1771:Ceacam1 UTSW 7 25472044 missense probably benign 0.17
R1819:Ceacam1 UTSW 7 25463860 missense possibly damaging 0.68
R1964:Ceacam1 UTSW 7 25474708 missense probably benign 0.13
R2048:Ceacam1 UTSW 7 25476688 missense probably benign 0.09
R2760:Ceacam1 UTSW 7 25477474 missense probably damaging 0.99
R2857:Ceacam1 UTSW 7 25474017 missense probably damaging 0.96
R2859:Ceacam1 UTSW 7 25474017 missense probably damaging 0.96
R3546:Ceacam1 UTSW 7 25471914 missense probably benign 0.07
R4471:Ceacam1 UTSW 7 25474600 missense possibly damaging 0.93
R4606:Ceacam1 UTSW 7 25474526 missense probably damaging 0.97
R4810:Ceacam1 UTSW 7 25474520 makesense probably null
R5291:Ceacam1 UTSW 7 25471831 missense probably damaging 0.99
R5405:Ceacam1 UTSW 7 25463865 missense probably benign 0.41
R5423:Ceacam1 UTSW 7 25474526 missense probably benign 0.01
R5851:Ceacam1 UTSW 7 25474600 missense possibly damaging 0.70
R5967:Ceacam1 UTSW 7 25474742 missense probably damaging 0.97
R6216:Ceacam1 UTSW 7 25471996 missense probably benign 0.19
R6235:Ceacam1 UTSW 7 25471792 splice site probably null
R6323:Ceacam1 UTSW 7 25474651 missense probably damaging 1.00
X0028:Ceacam1 UTSW 7 25476420 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGATTGCATTTTGCCTGTTCC -3'
(R):5'- CTCTGCTGACGTCACATTTG -3'

Sequencing Primer
(F):5'- TTGCCTGTTCCCATAGAAACAGG -3'
(R):5'- TTTGCTCCAGATGGTCCGGAC -3'
Posted On2018-06-06