Incidental Mutation 'R6520:Adam22'
ID521103
Institutional Source Beutler Lab
Gene Symbol Adam22
Ensembl Gene ENSMUSG00000040537
Gene Namea disintegrin and metallopeptidase domain 22
Synonyms2900022I03Rik, MDC2
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6520 (G1)
Quality Score199.009
Status Not validated
Chromosome5
Chromosomal Location8072352-8368160 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 8116635 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 699 (V699M)
Ref Sequence ENSEMBL: ENSMUSP00000111044 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046838] [ENSMUST00000050166] [ENSMUST00000088744] [ENSMUST00000088761] [ENSMUST00000115386] [ENSMUST00000115388] [ENSMUST00000123168] [ENSMUST00000126384] [ENSMUST00000130315] [ENSMUST00000136524] [ENSMUST00000136808] [ENSMUST00000139048] [ENSMUST00000139841] [ENSMUST00000144241] [ENSMUST00000153427] [ENSMUST00000153889] [ENSMUST00000154935] [ENSMUST00000197700] [ENSMUST00000199853]
Predicted Effect possibly damaging
Transcript: ENSMUST00000046838
AA Change: V699M

PolyPhen 2 Score 0.571 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000049120
Gene: ENSMUSG00000040537
AA Change: V699M

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:Pep_M12B_propep 44 186 7e-27 PFAM
low complexity region 214 230 N/A INTRINSIC
Pfam:Reprolysin_5 235 405 9.3e-9 PFAM
Pfam:Reprolysin 237 436 1.1e-58 PFAM
Pfam:Reprolysin_3 261 379 3e-12 PFAM
DISIN 451 527 3.38e-31 SMART
ACR 528 669 3.05e-58 SMART
EGF 676 710 1.28e1 SMART
transmembrane domain 735 757 N/A INTRINSIC
low complexity region 789 808 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000050166
AA Change: V699M

PolyPhen 2 Score 0.571 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000055000
Gene: ENSMUSG00000040537
AA Change: V699M

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:Pep_M12B_propep 44 186 7.6e-27 PFAM
low complexity region 214 230 N/A INTRINSIC
Pfam:Reprolysin_5 235 405 1.1e-8 PFAM
Pfam:Reprolysin 237 436 1.1e-58 PFAM
Pfam:Reprolysin_3 261 379 3.4e-12 PFAM
DISIN 451 527 3.38e-31 SMART
ACR 528 669 3.05e-58 SMART
EGF 676 710 1.28e1 SMART
transmembrane domain 735 757 N/A INTRINSIC
low complexity region 824 839 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000088744
AA Change: V699M

PolyPhen 2 Score 0.571 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000086122
Gene: ENSMUSG00000040537
AA Change: V699M

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:Pep_M12B_propep 41 186 4.2e-29 PFAM
low complexity region 214 230 N/A INTRINSIC
Pfam:Reprolysin_5 235 405 1.2e-8 PFAM
Pfam:Reprolysin 237 436 2.9e-65 PFAM
Pfam:Reprolysin_3 261 378 9.2e-13 PFAM
DISIN 451 527 3.38e-31 SMART
ACR 528 669 3.05e-58 SMART
EGF 676 710 1.28e1 SMART
transmembrane domain 736 758 N/A INTRINSIC
low complexity region 785 800 N/A INTRINSIC
low complexity region 883 898 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000088761
AA Change: V699M

PolyPhen 2 Score 0.571 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000086139
Gene: ENSMUSG00000040537
AA Change: V699M

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:Pep_M12B_propep 44 186 8.1e-27 PFAM
low complexity region 214 230 N/A INTRINSIC
Pfam:Reprolysin_5 235 405 1.2e-8 PFAM
Pfam:Reprolysin 237 436 1.1e-58 PFAM
Pfam:Reprolysin_3 261 379 3.6e-12 PFAM
DISIN 451 527 3.38e-31 SMART
ACR 528 669 3.05e-58 SMART
EGF 676 710 1.28e1 SMART
transmembrane domain 735 757 N/A INTRINSIC
low complexity region 789 808 N/A INTRINSIC
low complexity region 860 875 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000115386
AA Change: V699M

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000111044
Gene: ENSMUSG00000040537
AA Change: V699M

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:Pep_M12B_propep 44 186 3.4e-27 PFAM
low complexity region 214 230 N/A INTRINSIC
Pfam:Reprolysin_5 235 405 5.1e-9 PFAM
Pfam:Reprolysin 237 436 5e-59 PFAM
Pfam:Reprolysin_3 261 379 1.6e-12 PFAM
DISIN 451 527 3.38e-31 SMART
ACR 528 669 3.05e-58 SMART
EGF 676 710 1.28e1 SMART
transmembrane domain 735 757 N/A INTRINSIC
low complexity region 850 870 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000115388
AA Change: V699M

PolyPhen 2 Score 0.571 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000111046
Gene: ENSMUSG00000040537
AA Change: V699M

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:Pep_M12B_propep 44 186 8e-27 PFAM
low complexity region 214 230 N/A INTRINSIC
Pfam:Reprolysin_5 235 405 1.1e-8 PFAM
Pfam:Reprolysin 237 436 1.1e-58 PFAM
Pfam:Reprolysin_3 261 379 3.5e-12 PFAM
DISIN 451 527 3.38e-31 SMART
ACR 528 669 3.05e-58 SMART
EGF 676 710 1.28e1 SMART
transmembrane domain 735 757 N/A INTRINSIC
low complexity region 852 872 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000123168
SMART Domains Protein: ENSMUSP00000122758
Gene: ENSMUSG00000040537

DomainStartEndE-ValueType
transmembrane domain 27 49 N/A INTRINSIC
low complexity region 123 143 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000124121
AA Change: V81M
SMART Domains Protein: ENSMUSP00000122652
Gene: ENSMUSG00000040537
AA Change: V81M

DomainStartEndE-ValueType
Blast:ACR 2 52 5e-28 BLAST
EGF 59 93 1.28e1 SMART
transmembrane domain 118 140 N/A INTRINSIC
low complexity region 207 222 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000126384
SMART Domains Protein: ENSMUSP00000118571
Gene: ENSMUSG00000040537

DomainStartEndE-ValueType
transmembrane domain 27 49 N/A INTRINSIC
low complexity region 83 98 N/A INTRINSIC
low complexity region 181 196 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000130315
SMART Domains Protein: ENSMUSP00000121156
Gene: ENSMUSG00000040537

DomainStartEndE-ValueType
transmembrane domain 27 49 N/A INTRINSIC
low complexity region 150 170 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000136524
SMART Domains Protein: ENSMUSP00000116422
Gene: ENSMUSG00000040537

DomainStartEndE-ValueType
transmembrane domain 27 49 N/A INTRINSIC
low complexity region 152 172 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000136808
SMART Domains Protein: ENSMUSP00000122426
Gene: ENSMUSG00000040537

DomainStartEndE-ValueType
transmembrane domain 27 49 N/A INTRINSIC
low complexity region 83 98 N/A INTRINSIC
low complexity region 207 227 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000139048
SMART Domains Protein: ENSMUSP00000116736
Gene: ENSMUSG00000040537

DomainStartEndE-ValueType
transmembrane domain 27 49 N/A INTRINSIC
low complexity region 81 100 N/A INTRINSIC
low complexity region 186 206 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000139841
SMART Domains Protein: ENSMUSP00000115775
Gene: ENSMUSG00000040537

DomainStartEndE-ValueType
transmembrane domain 27 49 N/A INTRINSIC
low complexity region 144 164 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000144241
SMART Domains Protein: ENSMUSP00000138353
Gene: ENSMUSG00000040537

DomainStartEndE-ValueType
transmembrane domain 27 49 N/A INTRINSIC
low complexity region 75 94 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000153427
SMART Domains Protein: ENSMUSP00000120995
Gene: ENSMUSG00000040537

DomainStartEndE-ValueType
transmembrane domain 27 49 N/A INTRINSIC
low complexity region 75 94 N/A INTRINSIC
low complexity region 209 229 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000153889
SMART Domains Protein: ENSMUSP00000123196
Gene: ENSMUSG00000040537

DomainStartEndE-ValueType
transmembrane domain 27 49 N/A INTRINSIC
low complexity region 81 100 N/A INTRINSIC
low complexity region 152 167 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000154935
SMART Domains Protein: ENSMUSP00000119409
Gene: ENSMUSG00000040537

DomainStartEndE-ValueType
transmembrane domain 27 49 N/A INTRINSIC
low complexity region 83 98 N/A INTRINSIC
low complexity region 225 245 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000197700
SMART Domains Protein: ENSMUSP00000142580
Gene: ENSMUSG00000040537

DomainStartEndE-ValueType
transmembrane domain 27 49 N/A INTRINSIC
low complexity region 129 145 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000199853
SMART Domains Protein: ENSMUSP00000143097
Gene: ENSMUSG00000040537

DomainStartEndE-ValueType
transmembrane domain 27 49 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.5%
  • 20x: 92.0%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of a disintegrin and metalloprotease (ADAM) family of endoproteases that play important roles in various biological processes including cell signaling, adhesion and migration. The encoded preproprotein undergoes proteolytic processing to generate a mature, functional protein. The protein encoded by this gene is believed to lack metalloproteinase activity due to the lack of a critical catalytic motif. Mice lacking the encoded protein exhibit severe ataxia, hypomyelination and premature death. Alternative splicing results in multiple transcript variants encoding different isoforms, some of which may undergo similar processing. [provided by RefSeq, May 2016]
PHENOTYPE: Homozygous mutant mice exhibit severe ataxia, die before weaning and have marked hypomyelination of the peripheral nerves. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 89 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700037H04Rik G T 2: 131,147,254 H111N probably damaging Het
1700093K21Rik T C 11: 23,517,285 D116G possibly damaging Het
Adh7 A G 3: 138,224,010 Y149C probably damaging Het
Angptl3 A C 4: 99,037,848 N405T probably benign Het
Ank3 A G 10: 69,988,387 H180R probably damaging Het
Apob T A 12: 7,983,124 I159N probably damaging Het
Arhgap24 T C 5: 102,880,793 V185A probably benign Het
Atf6 A T 1: 170,867,669 H11Q probably benign Het
Atxn3 C A 12: 101,934,401 D208Y probably damaging Het
Brd9 G A 13: 73,942,794 R273K probably benign Het
Cbfa2t3 T A 8: 122,635,801 R302W probably benign Het
Ccdc175 C A 12: 72,140,030 G347C probably damaging Het
Ccdc87 A G 19: 4,841,789 K770E probably damaging Het
Ccl17 T C 8: 94,810,550 F27L probably benign Het
Cd3g A T 9: 44,971,315 probably null Het
Cep350 A G 1: 155,933,336 V498A probably benign Het
Cfap45 A G 1: 172,540,584 D381G probably damaging Het
Cfap46 A G 7: 139,614,405 probably null Het
Cnrip1 T A 11: 17,078,536 M156K probably damaging Het
Col23a1 T C 11: 51,549,725 probably null Het
Col4a1 C T 8: 11,219,152 G933S probably damaging Het
Col5a3 C T 9: 20,774,052 V1443I unknown Het
Col6a6 T C 9: 105,785,825 E171G possibly damaging Het
Dennd1a A T 2: 37,961,747 probably null Het
Dlk2 C T 17: 46,302,512 T188I probably damaging Het
Dusp8 A G 7: 142,083,681 I203T probably damaging Het
Eno2 C T 6: 124,767,715 R56H probably damaging Het
Erich3 A T 3: 154,763,465 T1185S probably damaging Het
Evi5l A T 8: 4,205,906 Q575L possibly damaging Het
Fam187a T A 11: 102,885,875 H168Q possibly damaging Het
Fat2 T A 11: 55,284,988 E1633V probably damaging Het
Fbln2 G A 6: 91,259,659 D719N probably damaging Het
Fbn2 A T 18: 58,102,390 S672T probably damaging Het
Gas8 C G 8: 123,526,474 A187G probably benign Het
Gm2696 G A 10: 77,836,498 probably benign Het
Gnl1 A T 17: 35,982,953 K272M probably benign Het
Gtf2h3 C T 5: 124,584,297 T121I probably benign Het
Hemgn T G 4: 46,396,466 K257Q probably damaging Het
Hgsnat T C 8: 25,953,300 Y474C probably damaging Het
Hoxc4 T C 15: 103,034,954 S78P probably benign Het
Igkv14-100 T A 6: 68,519,234 L37Q probably damaging Het
Iqck A T 7: 118,941,631 K251M probably damaging Het
Itgal A T 7: 127,330,331 Q1140L probably benign Het
Itpka A G 2: 119,750,778 R431G probably benign Het
Jade1 A G 3: 41,604,482 N333D possibly damaging Het
Jmjd7 A G 2: 120,031,319 H181R probably damaging Het
Jmy A G 13: 93,454,039 S519P probably benign Het
Klra10 T A 6: 130,275,792 H173L probably benign Het
Krt72 T G 15: 101,781,046 I284L probably benign Het
Krt78 C A 15: 101,951,771 V237F probably benign Het
Mapkapk3 G A 9: 107,257,449 T296M probably damaging Het
Mcmbp A C 7: 128,712,727 V255G possibly damaging Het
Mcoln1 T G 8: 3,505,855 M50R probably damaging Het
Mocos T A 18: 24,666,390 V227E probably benign Het
Mpeg1 A G 19: 12,461,958 E260G probably benign Het
Mrc1 A T 2: 14,307,949 N894I probably damaging Het
Mroh7 A G 4: 106,721,263 S73P probably benign Het
Myo3a A T 2: 22,399,926 I690L possibly damaging Het
Naa50 T G 16: 44,159,509 F87V probably damaging Het
Ndufs6 G T 13: 73,328,352 T32K probably damaging Het
Nfe2l2 A G 2: 75,676,568 V396A probably benign Het
Nptn A G 9: 58,643,734 E348G probably damaging Het
Nsun4 A T 4: 116,044,738 L177Q probably damaging Het
Olfr1083-ps A G 2: 86,607,118 L151P unknown Het
Olfr504 A G 7: 108,564,839 *319Q probably null Het
Olfr974 T C 9: 39,942,362 I34T possibly damaging Het
Plekha7 A G 7: 116,164,482 V233A probably benign Het
Polq C A 16: 37,060,377 Q968K possibly damaging Het
Prmt7 C T 8: 106,234,884 T143M probably damaging Het
Ptprc G A 1: 138,080,143 Q886* probably null Het
Rbp7 C A 4: 149,452,914 V36L possibly damaging Het
Rev3l A T 10: 39,822,702 N1065I probably benign Het
Scamp5 A T 9: 57,447,206 probably null Het
Sec16a A G 2: 26,426,106 S1698P probably damaging Het
Spr C A 6: 85,137,492 R85L probably benign Het
Sptlc2 A C 12: 87,355,662 N163K probably benign Het
Stk10 C T 11: 32,588,839 T226M probably damaging Het
Sv2c A G 13: 95,986,721 Y415H probably benign Het
Tet1 A G 10: 62,880,013 M1T probably null Het
Tnnt1 T A 7: 4,509,061 K150* probably null Het
Trappc10 C T 10: 78,201,453 V839M probably benign Het
Ubap2 T C 4: 41,195,155 N1131S probably damaging Het
Upk2 T C 9: 44,453,506 E132G probably damaging Het
Vmn2r117 A T 17: 23,460,219 V677D probably damaging Het
Vps13a A T 19: 16,725,579 L670H probably damaging Het
Wwc1 C T 11: 35,853,437 E853K probably benign Het
Zfp512 G A 5: 31,466,640 R67H probably damaging Het
Zfp804b T A 5: 6,769,283 H1260L probably damaging Het
Zzef1 C A 11: 72,826,065 N360K probably damaging Het
Other mutations in Adam22
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01325:Adam22 APN 5 8127333 missense probably benign 0.44
IGL01368:Adam22 APN 5 8127411 missense probably damaging 1.00
IGL01406:Adam22 APN 5 8130212 nonsense probably null
IGL01463:Adam22 APN 5 8092790 missense probably damaging 1.00
IGL01691:Adam22 APN 5 8092742 missense probably damaging 1.00
IGL01798:Adam22 APN 5 8232604 splice site probably null
IGL01975:Adam22 APN 5 8167396 missense probably damaging 1.00
IGL02076:Adam22 APN 5 8136900 missense probably damaging 1.00
IGL02170:Adam22 APN 5 8134845 missense probably benign
IGL02189:Adam22 APN 5 8330029 missense possibly damaging 0.91
IGL02859:Adam22 APN 5 8167375 missense probably damaging 1.00
IGL03189:Adam22 APN 5 8111897 nonsense probably null
IGL03326:Adam22 APN 5 8127421 missense probably damaging 1.00
IGL03329:Adam22 APN 5 8149210 missense possibly damaging 0.48
IGL03354:Adam22 APN 5 8158890 missense possibly damaging 0.82
IGL03394:Adam22 APN 5 8167379 missense probably benign 0.00
IGL03047:Adam22 UTSW 5 8082220 missense probably damaging 1.00
R0445:Adam22 UTSW 5 8180591 intron probably benign
R0486:Adam22 UTSW 5 8330048 missense probably damaging 1.00
R0669:Adam22 UTSW 5 8143036 splice site probably benign
R0866:Adam22 UTSW 5 8082156 missense probably damaging 0.98
R1510:Adam22 UTSW 5 8152408 missense probably benign 0.06
R1562:Adam22 UTSW 5 8095007 missense probably damaging 1.00
R1640:Adam22 UTSW 5 8145689 missense probably damaging 1.00
R1903:Adam22 UTSW 5 8134525 missense probably damaging 1.00
R1939:Adam22 UTSW 5 8330015 missense probably damaging 1.00
R1998:Adam22 UTSW 5 8329995 missense probably damaging 1.00
R2012:Adam22 UTSW 5 8117634 missense probably damaging 1.00
R2214:Adam22 UTSW 5 8136805 critical splice donor site probably null
R2270:Adam22 UTSW 5 8121108 missense probably damaging 0.98
R2271:Adam22 UTSW 5 8121108 missense probably damaging 0.98
R2286:Adam22 UTSW 5 8145616 missense probably damaging 1.00
R2304:Adam22 UTSW 5 8092366 missense probably damaging 1.00
R2406:Adam22 UTSW 5 8180064 intron probably benign
R2656:Adam22 UTSW 5 8117696 missense probably damaging 1.00
R3106:Adam22 UTSW 5 8117583 splice site probably null
R3870:Adam22 UTSW 5 8132418 missense probably damaging 1.00
R3923:Adam22 UTSW 5 8130514 missense possibly damaging 0.68
R4092:Adam22 UTSW 5 8095004 missense probably damaging 1.00
R4180:Adam22 UTSW 5 8149218 missense probably damaging 1.00
R4247:Adam22 UTSW 5 8145626 missense probably benign
R4486:Adam22 UTSW 5 8180227 intron probably benign
R4629:Adam22 UTSW 5 8232663 missense possibly damaging 0.95
R4744:Adam22 UTSW 5 8078699 missense probably damaging 0.98
R4839:Adam22 UTSW 5 8136813 missense probably damaging 1.00
R5007:Adam22 UTSW 5 8167393 missense probably damaging 1.00
R5030:Adam22 UTSW 5 8179645 intron probably benign
R5061:Adam22 UTSW 5 8180238 intron probably benign
R5312:Adam22 UTSW 5 8090182 missense probably damaging 1.00
R5353:Adam22 UTSW 5 8090182 missense probably damaging 1.00
R5354:Adam22 UTSW 5 8090182 missense probably damaging 1.00
R5356:Adam22 UTSW 5 8090182 missense probably damaging 1.00
R5423:Adam22 UTSW 5 8090182 missense probably damaging 1.00
R5424:Adam22 UTSW 5 8090182 missense probably damaging 1.00
R5719:Adam22 UTSW 5 8367217 missense probably benign
R5763:Adam22 UTSW 5 8134544 missense probably damaging 1.00
R5768:Adam22 UTSW 5 8127426 missense probably benign 0.35
R5776:Adam22 UTSW 5 8127361 missense probably benign 0.26
R5839:Adam22 UTSW 5 8136861 missense probably damaging 0.99
R6314:Adam22 UTSW 5 8127365 nonsense probably null
R6798:Adam22 UTSW 5 8160784 missense probably damaging 1.00
R6924:Adam22 UTSW 5 8367322 missense possibly damaging 0.78
R6938:Adam22 UTSW 5 8146499 missense probably benign 0.01
R7317:Adam22 UTSW 5 8090202 missense probably benign
X0067:Adam22 UTSW 5 8127329 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- GACCTCACTCGTTATGTAGATACC -3'
(R):5'- TATCCAGTTAAGGCAGAAGGC -3'

Sequencing Primer
(F):5'- CTGATACCTACCATTGCCAG -3'
(R):5'- GCATTGGATTGGAATTTGAAGCAC -3'
Posted On2018-06-06