Incidental Mutation 'R6545:Olfr509'
ID521104
Institutional Source Beutler Lab
Gene Symbol Olfr509
Ensembl Gene ENSMUSG00000049280
Gene Nameolfactory receptor 509
SynonymsGA_x6K02T2PBJ9-10976304-10975339, MOR267-14
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.062) question?
Stock #R6545 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location108644336-108651906 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 108646455 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 40 (N40K)
Ref Sequence ENSEMBL: ENSMUSP00000150157 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061690] [ENSMUST00000213756] [ENSMUST00000214861] [ENSMUST00000215075]
Predicted Effect probably damaging
Transcript: ENSMUST00000061690
AA Change: N40K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000053819
Gene: ENSMUSG00000049280
AA Change: N40K

DomainStartEndE-ValueType
Pfam:7tm_4 29 305 1.8e-42 PFAM
Pfam:7tm_1 39 288 1.5e-13 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000213756
AA Change: N40K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000214861
AA Change: N40K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000215075
AA Change: N40K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.6%
Validation Efficiency 95% (42/44)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ago1 C T 4: 126,454,352 A58T possibly damaging Het
Ago4 T A 4: 126,512,018 Q366L probably benign Het
Card10 C A 15: 78,776,810 G950V probably damaging Het
Ceacam1 A T 7: 25,473,854 V303D probably damaging Het
Cfap54 C T 10: 92,836,457 R2917H probably benign Het
Cit A G 5: 115,846,434 S22G probably null Het
Cog4 A G 8: 110,880,945 E666G probably damaging Het
Crocc2 A G 1: 93,212,937 D1103G probably benign Het
Cttnbp2 A T 6: 18,405,279 probably null Het
Dctn3 T C 4: 41,723,084 E16G probably damaging Het
Dnah6 A G 6: 73,044,732 S3536P probably damaging Het
Eef2 T A 10: 81,181,114 I675N probably damaging Het
Gga3 A G 11: 115,587,169 F531S possibly damaging Het
Gm19410 A G 8: 35,790,498 R697G possibly damaging Het
Gm3173 T A 14: 4,514,810 M18K possibly damaging Het
Gm35339 C T 15: 76,363,378 R1585C probably damaging Het
Gm5800 A T 14: 51,711,962 S175R possibly damaging Het
Gria2 T C 3: 80,741,144 K95R probably damaging Het
Gstm6 A G 3: 107,942,365 I76T probably damaging Het
Harbi1 T G 2: 91,712,295 Y34D probably damaging Het
Hectd2 C A 19: 36,587,378 Q20K probably benign Het
Inpp5f C A 7: 128,694,556 A250D possibly damaging Het
Irf9 T C 14: 55,605,227 F59L probably damaging Het
Itgam T A 7: 128,107,872 M625K probably damaging Het
Kcnh5 C T 12: 75,007,658 R504Q probably damaging Het
Lama2 T C 10: 27,176,797 T1389A probably benign Het
Lin54 T A 5: 100,485,137 probably null Het
Mettl23 A G 11: 116,849,216 D171G possibly damaging Het
Mgll A G 6: 88,825,703 N296S probably benign Het
Mpv17 T A 5: 31,144,697 probably benign Het
Myof A T 19: 37,942,297 M1001K possibly damaging Het
Myom1 A T 17: 71,082,305 Q850L probably benign Het
Pias2 A G 18: 77,130,085 I328V possibly damaging Het
Polh G A 17: 46,182,759 P311S possibly damaging Het
Prss34 A T 17: 25,298,835 R61S probably benign Het
Rassf2 A T 2: 131,998,317 M280K probably damaging Het
Rpsa A G 9: 120,130,257 H47R probably benign Het
Rtp3 A G 9: 110,986,826 V219A possibly damaging Het
Smarcc2 T C 10: 128,484,128 I790T probably benign Het
Stag3 A G 5: 138,298,352 T491A possibly damaging Het
Svil C T 18: 5,108,621 H2007Y probably benign Het
Togaram1 T G 12: 64,978,207 C750G possibly damaging Het
Vmn2r13 A T 5: 109,156,940 probably null Het
Vmn2r4 A T 3: 64,406,356 D401E possibly damaging Het
Wsb1 A T 11: 79,251,055 D45E probably damaging Het
Zfp808 T A 13: 62,171,895 Y313N probably benign Het
Other mutations in Olfr509
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00095:Olfr509 APN 7 108645836 missense possibly damaging 0.47
IGL02015:Olfr509 APN 7 108646013 missense probably damaging 0.99
IGL02721:Olfr509 APN 7 108646375 nonsense probably null
IGL03170:Olfr509 APN 7 108646100 missense probably benign 0.00
R0746:Olfr509 UTSW 7 108646041 missense probably damaging 1.00
R0863:Olfr509 UTSW 7 108645658 missense probably benign 0.00
R1791:Olfr509 UTSW 7 108646364 missense probably benign 0.30
R4128:Olfr509 UTSW 7 108646426 missense probably benign 0.03
R5290:Olfr509 UTSW 7 108646548 missense probably benign
R5878:Olfr509 UTSW 7 108645739 missense probably damaging 1.00
R6030:Olfr509 UTSW 7 108646226 missense possibly damaging 0.87
R6030:Olfr509 UTSW 7 108646226 missense possibly damaging 0.87
Predicted Primers PCR Primer
(F):5'- TATTGCCTCCCAAGCCAAAG -3'
(R):5'- ACAAGCTCGTCACAGTCATC -3'

Sequencing Primer
(F):5'- AAGAAAAACATCTGAGTGGCAC -3'
(R):5'- AAGCTCGTCACAGTCATCTCTGAATC -3'
Posted On2018-06-06