Incidental Mutation 'R6545:Inpp5f'
ID521108
Institutional Source Beutler Lab
Gene Symbol Inpp5f
Ensembl Gene ENSMUSG00000042105
Gene Nameinositol polyphosphate-5-phosphatase F
SynonymscI-27, 5830435P03Rik, SAC2
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.327) question?
Stock #R6545 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location128611328-128696425 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 128694556 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Aspartic acid at position 250 (A250D)
Ref Sequence ENSEMBL: ENSMUSP00000113700 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043138] [ENSMUST00000057557] [ENSMUST00000118605] [ENSMUST00000119081] [ENSMUST00000151237] [ENSMUST00000202419]
Predicted Effect possibly damaging
Transcript: ENSMUST00000043138
AA Change: A877D

PolyPhen 2 Score 0.539 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000045910
Gene: ENSMUSG00000042105
AA Change: A877D

DomainStartEndE-ValueType
Pfam:Syja_N 49 416 1.2e-85 PFAM
Blast:IPPc 449 568 6e-13 BLAST
Pfam:hSac2 590 698 9.1e-25 PFAM
low complexity region 1042 1054 N/A INTRINSIC
low complexity region 1059 1065 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000057557
SMART Domains Protein: ENSMUSP00000062843
Gene: ENSMUSG00000048170

DomainStartEndE-ValueType
Pfam:MCM_bind 37 166 1.6e-44 PFAM
Pfam:Racemase_4 352 451 1.5e-38 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000118475
Predicted Effect possibly damaging
Transcript: ENSMUST00000118605
AA Change: A250D

PolyPhen 2 Score 0.876 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000113700
Gene: ENSMUSG00000042105
AA Change: A250D

DomainStartEndE-ValueType
Pfam:hSac2 1 73 8.9e-21 PFAM
low complexity region 415 427 N/A INTRINSIC
low complexity region 432 438 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000119081
SMART Domains Protein: ENSMUSP00000113961
Gene: ENSMUSG00000048170

DomainStartEndE-ValueType
Pfam:MCM_bind 36 588 3.6e-210 PFAM
low complexity region 603 623 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127807
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140714
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142075
Predicted Effect possibly damaging
Transcript: ENSMUST00000151237
AA Change: A186D

PolyPhen 2 Score 0.539 (Sensitivity: 0.88; Specificity: 0.90)
Predicted Effect probably benign
Transcript: ENSMUST00000202419
SMART Domains Protein: ENSMUSP00000143952
Gene: ENSMUSG00000042105

DomainStartEndE-ValueType
low complexity region 8 22 N/A INTRINSIC
Pfam:VMA21 30 84 9.9e-9 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.6%
Validation Efficiency 95% (42/44)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an inositol 1,4,5-trisphosphate (InsP3) 5-phosphatase and contains a Sac domain. The activity of this protein is specific for phosphatidylinositol 4,5-bisphosphate and phosphatidylinositol 3,4,5-trisphosphate. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Aug 2011]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit increased isoproterenol-induced cardiac hypertrophy. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ago1 C T 4: 126,454,352 A58T possibly damaging Het
Ago4 T A 4: 126,512,018 Q366L probably benign Het
Card10 C A 15: 78,776,810 G950V probably damaging Het
Ceacam1 A T 7: 25,473,854 V303D probably damaging Het
Cfap54 C T 10: 92,836,457 R2917H probably benign Het
Cit A G 5: 115,846,434 S22G probably null Het
Cog4 A G 8: 110,880,945 E666G probably damaging Het
Crocc2 A G 1: 93,212,937 D1103G probably benign Het
Cttnbp2 A T 6: 18,405,279 probably null Het
Dctn3 T C 4: 41,723,084 E16G probably damaging Het
Dnah6 A G 6: 73,044,732 S3536P probably damaging Het
Eef2 T A 10: 81,181,114 I675N probably damaging Het
Gga3 A G 11: 115,587,169 F531S possibly damaging Het
Gm19410 A G 8: 35,790,498 R697G possibly damaging Het
Gm3173 T A 14: 4,514,810 M18K possibly damaging Het
Gm35339 C T 15: 76,363,378 R1585C probably damaging Het
Gm5800 A T 14: 51,711,962 S175R possibly damaging Het
Gria2 T C 3: 80,741,144 K95R probably damaging Het
Gstm6 A G 3: 107,942,365 I76T probably damaging Het
Harbi1 T G 2: 91,712,295 Y34D probably damaging Het
Hectd2 C A 19: 36,587,378 Q20K probably benign Het
Irf9 T C 14: 55,605,227 F59L probably damaging Het
Itgam T A 7: 128,107,872 M625K probably damaging Het
Kcnh5 C T 12: 75,007,658 R504Q probably damaging Het
Lama2 T C 10: 27,176,797 T1389A probably benign Het
Lin54 T A 5: 100,485,137 probably null Het
Mettl23 A G 11: 116,849,216 D171G possibly damaging Het
Mgll A G 6: 88,825,703 N296S probably benign Het
Mpv17 T A 5: 31,144,697 probably benign Het
Myof A T 19: 37,942,297 M1001K possibly damaging Het
Myom1 A T 17: 71,082,305 Q850L probably benign Het
Olfr509 A T 7: 108,646,455 N40K probably damaging Het
Pias2 A G 18: 77,130,085 I328V possibly damaging Het
Polh G A 17: 46,182,759 P311S possibly damaging Het
Prss34 A T 17: 25,298,835 R61S probably benign Het
Rassf2 A T 2: 131,998,317 M280K probably damaging Het
Rpsa A G 9: 120,130,257 H47R probably benign Het
Rtp3 A G 9: 110,986,826 V219A possibly damaging Het
Smarcc2 T C 10: 128,484,128 I790T probably benign Het
Stag3 A G 5: 138,298,352 T491A possibly damaging Het
Svil C T 18: 5,108,621 H2007Y probably benign Het
Togaram1 T G 12: 64,978,207 C750G possibly damaging Het
Vmn2r13 A T 5: 109,156,940 probably null Het
Vmn2r4 A T 3: 64,406,356 D401E possibly damaging Het
Wsb1 A T 11: 79,251,055 D45E probably damaging Het
Zfp808 T A 13: 62,171,895 Y313N probably benign Het
Other mutations in Inpp5f
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00650:Inpp5f APN 7 128664267 missense probably benign 0.04
IGL01316:Inpp5f APN 7 128690706 splice site probably benign
IGL01455:Inpp5f APN 7 128678049 missense probably damaging 1.00
IGL01471:Inpp5f APN 7 128675398 missense probably damaging 0.99
IGL01590:Inpp5f APN 7 128664307 critical splice donor site probably null
IGL01942:Inpp5f APN 7 128667769 missense probably damaging 1.00
IGL02092:Inpp5f APN 7 128685224 missense probably damaging 1.00
IGL02137:Inpp5f APN 7 128695129 missense probably damaging 1.00
IGL02664:Inpp5f APN 7 128664014 missense probably damaging 1.00
IGL02812:Inpp5f APN 7 128682306 missense probably damaging 1.00
IGL02942:Inpp5f APN 7 128694900 missense probably benign 0.29
PIT4480001:Inpp5f UTSW 7 128685134 missense probably benign 0.32
PIT4812001:Inpp5f UTSW 7 128692308 missense probably benign 0.39
R0243:Inpp5f UTSW 7 128695183 missense probably damaging 1.00
R0346:Inpp5f UTSW 7 128690668 missense probably damaging 1.00
R1186:Inpp5f UTSW 7 128694583 missense probably benign
R1375:Inpp5f UTSW 7 128664029 nonsense probably null
R1918:Inpp5f UTSW 7 128663969 splice site probably benign
R2307:Inpp5f UTSW 7 128694310 missense probably damaging 1.00
R3716:Inpp5f UTSW 7 128690670 missense probably damaging 1.00
R4157:Inpp5f UTSW 7 128679699 intron probably benign
R4647:Inpp5f UTSW 7 128659109 missense possibly damaging 0.94
R4705:Inpp5f UTSW 7 128663987 missense probably damaging 0.97
R4713:Inpp5f UTSW 7 128663725 missense probably damaging 0.99
R4818:Inpp5f UTSW 7 128685129 missense probably damaging 1.00
R4914:Inpp5f UTSW 7 128685116 missense probably damaging 1.00
R4915:Inpp5f UTSW 7 128685116 missense probably damaging 1.00
R4917:Inpp5f UTSW 7 128685116 missense probably damaging 1.00
R5069:Inpp5f UTSW 7 128676727 critical splice acceptor site probably null
R5181:Inpp5f UTSW 7 128679831 missense probably damaging 1.00
R5234:Inpp5f UTSW 7 128663683 missense probably benign
R6299:Inpp5f UTSW 7 128636160 missense possibly damaging 0.87
R6389:Inpp5f UTSW 7 128678056 missense probably damaging 1.00
R6530:Inpp5f UTSW 7 128664078 nonsense probably null
R7259:Inpp5f UTSW 7 128669957 missense probably benign 0.00
X0061:Inpp5f UTSW 7 128682297 missense probably damaging 1.00
Z1088:Inpp5f UTSW 7 128694949 missense probably benign 0.17
Predicted Primers PCR Primer
(F):5'- CGGCAACCTACGAAAATTAGG -3'
(R):5'- CAGGCCTTTCCCAAGTTCAC -3'

Sequencing Primer
(F):5'- GGAAACTTTACAAAGCCTGAAATG -3'
(R):5'- GTTCACTTCCAGGACCAGCAG -3'
Posted On2018-06-06