Incidental Mutation 'R6545:Rpsa'
ID521116
Institutional Source Beutler Lab
Gene Symbol Rpsa
Ensembl Gene ENSMUSG00000032518
Gene Nameribosomal protein SA
SynonymsLamr, P40-8, 67lr, Lamrl1, Lamr1, P40-3
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6545 (G1)
Quality Score136.008
Status Validated
Chromosome9
Chromosomal Location120127689-120132369 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 120130257 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 47 (H47R)
Ref Sequence ENSEMBL: ENSMUSP00000149650 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035105] [ENSMUST00000217317] [ENSMUST00000217352] [ENSMUST00000217356]
Predicted Effect probably benign
Transcript: ENSMUST00000035105
AA Change: H131R

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000035105
Gene: ENSMUSG00000032518
AA Change: H131R

DomainStartEndE-ValueType
Pfam:Ribosomal_S2 18 118 3.7e-12 PFAM
Pfam:Ribosomal_S2 111 184 6.5e-14 PFAM
Pfam:40S_SA_C 202 295 2.9e-30 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000082446
Predicted Effect noncoding transcript
Transcript: ENSMUST00000082991
Predicted Effect noncoding transcript
Transcript: ENSMUST00000083107
Predicted Effect noncoding transcript
Transcript: ENSMUST00000214963
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215568
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216043
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216813
Predicted Effect probably benign
Transcript: ENSMUST00000217317
AA Change: H131R

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
Predicted Effect probably benign
Transcript: ENSMUST00000217352
AA Change: H47R

PolyPhen 2 Score 0.113 (Sensitivity: 0.93; Specificity: 0.86)
Predicted Effect probably benign
Transcript: ENSMUST00000217356
Meta Mutation Damage Score 0.21 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.6%
Validation Efficiency 95% (42/44)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Laminins, a family of extracellular matrix glycoproteins, are the major noncollagenous constituent of basement membranes. They have been implicated in a wide variety of biological processes including cell adhesion, differentiation, migration, signaling, neurite outgrowth and metastasis. Many of the effects of laminin are mediated through interactions with cell surface receptors. These receptors include members of the integrin family, as well as non-integrin laminin-binding proteins. This gene encodes a high-affinity, non-integrin family, laminin receptor 1. This receptor has been variously called 67 kD laminin receptor, 37 kD laminin receptor precursor (37LRP) and p40 ribosome-associated protein. The amino acid sequence of laminin receptor 1 is highly conserved through evolution, suggesting a key biological function. It has been observed that the level of the laminin receptor transcript is higher in colon carcinoma tissue and lung cancer cell line than their normal counterparts. Also, there is a correlation between the upregulation of this polypeptide in cancer cells and their invasive and metastatic phenotype. Multiple copies of this gene exist, however, most of them are pseudogenes thought to have arisen from retropositional events. Two alternatively spliced transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Spontaneous mutants show right ventricular cardiomyocyte degeneration and higher susceptibility to arrhythmia. Homozygous null mice fail to develop past E3.5; heterozygotes show craniofacial defects, low mean corpuscular hemoglobin concentration and reduced insulin content in pancreatic islet cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ago1 C T 4: 126,454,352 A58T possibly damaging Het
Ago4 T A 4: 126,512,018 Q366L probably benign Het
Card10 C A 15: 78,776,810 G950V probably damaging Het
Ceacam1 A T 7: 25,473,854 V303D probably damaging Het
Cfap54 C T 10: 92,836,457 R2917H probably benign Het
Cit A G 5: 115,846,434 S22G probably null Het
Cog4 A G 8: 110,880,945 E666G probably damaging Het
Crocc2 A G 1: 93,212,937 D1103G probably benign Het
Cttnbp2 A T 6: 18,405,279 probably null Het
Dctn3 T C 4: 41,723,084 E16G probably damaging Het
Dnah6 A G 6: 73,044,732 S3536P probably damaging Het
Eef2 T A 10: 81,181,114 I675N probably damaging Het
Gga3 A G 11: 115,587,169 F531S possibly damaging Het
Gm19410 A G 8: 35,790,498 R697G possibly damaging Het
Gm3173 T A 14: 4,514,810 M18K possibly damaging Het
Gm35339 C T 15: 76,363,378 R1585C probably damaging Het
Gm5800 A T 14: 51,711,962 S175R possibly damaging Het
Gria2 T C 3: 80,741,144 K95R probably damaging Het
Gstm6 A G 3: 107,942,365 I76T probably damaging Het
Harbi1 T G 2: 91,712,295 Y34D probably damaging Het
Hectd2 C A 19: 36,587,378 Q20K probably benign Het
Inpp5f C A 7: 128,694,556 A250D possibly damaging Het
Irf9 T C 14: 55,605,227 F59L probably damaging Het
Itgam T A 7: 128,107,872 M625K probably damaging Het
Kcnh5 C T 12: 75,007,658 R504Q probably damaging Het
Lama2 T C 10: 27,176,797 T1389A probably benign Het
Lin54 T A 5: 100,485,137 probably null Het
Mettl23 A G 11: 116,849,216 D171G possibly damaging Het
Mgll A G 6: 88,825,703 N296S probably benign Het
Mpv17 T A 5: 31,144,697 probably benign Het
Myof A T 19: 37,942,297 M1001K possibly damaging Het
Myom1 A T 17: 71,082,305 Q850L probably benign Het
Olfr509 A T 7: 108,646,455 N40K probably damaging Het
Pias2 A G 18: 77,130,085 I328V possibly damaging Het
Polh G A 17: 46,182,759 P311S possibly damaging Het
Prss34 A T 17: 25,298,835 R61S probably benign Het
Rassf2 A T 2: 131,998,317 M280K probably damaging Het
Rtp3 A G 9: 110,986,826 V219A possibly damaging Het
Smarcc2 T C 10: 128,484,128 I790T probably benign Het
Stag3 A G 5: 138,298,352 T491A possibly damaging Het
Svil C T 18: 5,108,621 H2007Y probably benign Het
Togaram1 T G 12: 64,978,207 C750G possibly damaging Het
Vmn2r13 A T 5: 109,156,940 probably null Het
Vmn2r4 A T 3: 64,406,356 D401E possibly damaging Het
Wsb1 A T 11: 79,251,055 D45E probably damaging Het
Zfp808 T A 13: 62,171,895 Y313N probably benign Het
Other mutations in Rpsa
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02503:Rpsa APN 9 120128593 missense possibly damaging 0.57
IGL02522:Rpsa APN 9 120131055 missense possibly damaging 0.47
PIT4515001:Rpsa UTSW 9 120131148 missense probably benign 0.04
R0281:Rpsa UTSW 9 120131003 missense possibly damaging 0.81
R1511:Rpsa UTSW 9 120131000 missense possibly damaging 0.64
R4942:Rpsa UTSW 9 120131063 missense probably benign 0.04
R5814:Rpsa UTSW 9 120128485 start gained probably benign
R6122:Rpsa UTSW 9 120131036 missense probably benign 0.01
R7225:Rpsa UTSW 9 120131156 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TCCTCGTGAAGCATGCATG -3'
(R):5'- ACTTGTGAGTTCATCGACCAGC -3'

Sequencing Primer
(F):5'- CCTCGTGAAGCATGCATGATAATG -3'
(R):5'- TTCATCGACCAGCGTGTGAC -3'
Posted On2018-06-06