Incidental Mutation 'R6545:Eef2'
ID521120
Institutional Source Beutler Lab
Gene Symbol Eef2
Ensembl Gene ENSMUSG00000034994
Gene Nameeukaryotic translation elongation factor 2
SynonymsEf-2
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.970) question?
Stock #R6545 (G1)
Quality Score193.009
Status Validated
Chromosome10
Chromosomal Location81176631-81182498 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 81181114 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 675 (I675N)
Ref Sequence ENSEMBL: ENSMUSP00000046101 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047665] [ENSMUST00000047864] [ENSMUST00000056086] [ENSMUST00000178422] [ENSMUST00000218157] [ENSMUST00000219133] [ENSMUST00000219850]
Predicted Effect probably benign
Transcript: ENSMUST00000047665
SMART Domains Protein: ENSMUSP00000035962
Gene: ENSMUSG00000034974

DomainStartEndE-ValueType
S_TKc 13 275 1.93e-98 SMART
low complexity region 288 299 N/A INTRINSIC
low complexity region 331 347 N/A INTRINSIC
low complexity region 349 411 N/A INTRINSIC
coiled coil region 419 444 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000047864
AA Change: I675N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000046101
Gene: ENSMUSG00000034994
AA Change: I675N

DomainStartEndE-ValueType
Pfam:GTP_EFTU 17 360 2e-65 PFAM
Pfam:MMR_HSR1 21 159 6.3e-6 PFAM
Pfam:GTP_EFTU_D2 409 486 2.3e-14 PFAM
Pfam:EFG_II 501 568 1.9e-14 PFAM
EFG_IV 621 737 5.56e-27 SMART
EFG_C 739 828 4.06e-20 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000056086
SMART Domains Protein: ENSMUSP00000049685
Gene: ENSMUSG00000053603

DomainStartEndE-ValueType
low complexity region 2 14 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000082507
Predicted Effect probably benign
Transcript: ENSMUST00000178422
SMART Domains Protein: ENSMUSP00000137333
Gene: ENSMUSG00000034974

DomainStartEndE-ValueType
S_TKc 13 275 1.93e-98 SMART
low complexity region 288 299 N/A INTRINSIC
low complexity region 331 347 N/A INTRINSIC
low complexity region 349 411 N/A INTRINSIC
coiled coil region 419 444 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217936
Predicted Effect probably benign
Transcript: ENSMUST00000218157
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218698
Predicted Effect probably benign
Transcript: ENSMUST00000219133
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219329
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219497
Predicted Effect probably benign
Transcript: ENSMUST00000219850
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219943
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220076
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.6%
Validation Efficiency 95% (42/44)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the GTP-binding translation elongation factor family. This protein is an essential factor for protein synthesis. It promotes the GTP-dependent translocation of the nascent protein chain from the A-site to the P-site of the ribosome. This protein is completely inactivated by EF-2 kinase phosporylation. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a mutation removing the diphthamide modification display partial neonatal lethality, fetal growth retardation and abnormal cell physiology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ago1 C T 4: 126,454,352 A58T possibly damaging Het
Ago4 T A 4: 126,512,018 Q366L probably benign Het
Card10 C A 15: 78,776,810 G950V probably damaging Het
Ceacam1 A T 7: 25,473,854 V303D probably damaging Het
Cfap54 C T 10: 92,836,457 R2917H probably benign Het
Cit A G 5: 115,846,434 S22G probably null Het
Cog4 A G 8: 110,880,945 E666G probably damaging Het
Crocc2 A G 1: 93,212,937 D1103G probably benign Het
Cttnbp2 A T 6: 18,405,279 probably null Het
Dctn3 T C 4: 41,723,084 E16G probably damaging Het
Dnah6 A G 6: 73,044,732 S3536P probably damaging Het
Gga3 A G 11: 115,587,169 F531S possibly damaging Het
Gm19410 A G 8: 35,790,498 R697G possibly damaging Het
Gm3173 T A 14: 4,514,810 M18K possibly damaging Het
Gm35339 C T 15: 76,363,378 R1585C probably damaging Het
Gm5800 A T 14: 51,711,962 S175R possibly damaging Het
Gria2 T C 3: 80,741,144 K95R probably damaging Het
Gstm6 A G 3: 107,942,365 I76T probably damaging Het
Harbi1 T G 2: 91,712,295 Y34D probably damaging Het
Hectd2 C A 19: 36,587,378 Q20K probably benign Het
Inpp5f C A 7: 128,694,556 A250D possibly damaging Het
Irf9 T C 14: 55,605,227 F59L probably damaging Het
Itgam T A 7: 128,107,872 M625K probably damaging Het
Kcnh5 C T 12: 75,007,658 R504Q probably damaging Het
Lama2 T C 10: 27,176,797 T1389A probably benign Het
Lin54 T A 5: 100,485,137 probably null Het
Mettl23 A G 11: 116,849,216 D171G possibly damaging Het
Mgll A G 6: 88,825,703 N296S probably benign Het
Mpv17 T A 5: 31,144,697 probably benign Het
Myof A T 19: 37,942,297 M1001K possibly damaging Het
Myom1 A T 17: 71,082,305 Q850L probably benign Het
Olfr509 A T 7: 108,646,455 N40K probably damaging Het
Pias2 A G 18: 77,130,085 I328V possibly damaging Het
Polh G A 17: 46,182,759 P311S possibly damaging Het
Prss34 A T 17: 25,298,835 R61S probably benign Het
Rassf2 A T 2: 131,998,317 M280K probably damaging Het
Rpsa A G 9: 120,130,257 H47R probably benign Het
Rtp3 A G 9: 110,986,826 V219A possibly damaging Het
Smarcc2 T C 10: 128,484,128 I790T probably benign Het
Stag3 A G 5: 138,298,352 T491A possibly damaging Het
Svil C T 18: 5,108,621 H2007Y probably benign Het
Togaram1 T G 12: 64,978,207 C750G possibly damaging Het
Vmn2r13 A T 5: 109,156,940 probably null Het
Vmn2r4 A T 3: 64,406,356 D401E possibly damaging Het
Wsb1 A T 11: 79,251,055 D45E probably damaging Het
Zfp808 T A 13: 62,171,895 Y313N probably benign Het
Other mutations in Eef2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01303:Eef2 APN 10 81181943 missense possibly damaging 0.93
IGL01303:Eef2 APN 10 81181982 unclassified probably null
IGL01376:Eef2 APN 10 81178049 unclassified probably benign
IGL01876:Eef2 APN 10 81180270 missense probably benign
IGL02000:Eef2 APN 10 81180011 missense probably benign 0.13
IGL02514:Eef2 APN 10 81179593 missense probably benign 0.11
IGL03087:Eef2 APN 10 81181247 missense probably benign 0.12
IGL03389:Eef2 APN 10 81179706 missense probably benign 0.40
fig UTSW 10 81180292 missense possibly damaging 0.50
R0052:Eef2 UTSW 10 81178768 frame shift probably null
R0178:Eef2 UTSW 10 81180292 missense possibly damaging 0.50
R0445:Eef2 UTSW 10 81178770 frame shift probably null
R0497:Eef2 UTSW 10 81181586 missense probably benign 0.00
R0539:Eef2 UTSW 10 81178768 frame shift probably null
R0745:Eef2 UTSW 10 81181996 missense probably benign 0.00
R0811:Eef2 UTSW 10 81178769 frame shift probably null
R0812:Eef2 UTSW 10 81178769 frame shift probably null
R0832:Eef2 UTSW 10 81178769 frame shift probably null
R1136:Eef2 UTSW 10 81178769 frame shift probably null
R1298:Eef2 UTSW 10 81178768 frame shift probably null
R1549:Eef2 UTSW 10 81178768 frame shift probably null
R1550:Eef2 UTSW 10 81180847 missense probably benign 0.04
R2869:Eef2 UTSW 10 81178767 frame shift probably null
R2870:Eef2 UTSW 10 81178767 frame shift probably null
R2871:Eef2 UTSW 10 81178767 frame shift probably null
R2872:Eef2 UTSW 10 81178767 frame shift probably null
R3408:Eef2 UTSW 10 81178767 frame shift probably null
R3414:Eef2 UTSW 10 81177858 missense probably damaging 0.98
R4291:Eef2 UTSW 10 81179580 missense probably benign 0.00
R4357:Eef2 UTSW 10 81178767 frame shift probably null
R4433:Eef2 UTSW 10 81178768 frame shift probably null
R4577:Eef2 UTSW 10 81178767 frame shift probably null
R5154:Eef2 UTSW 10 81178767 frame shift probably null
R5609:Eef2 UTSW 10 81178769 frame shift probably null
R6649:Eef2 UTSW 10 81178768 frame shift probably null
R6650:Eef2 UTSW 10 81178768 frame shift probably null
Z1088:Eef2 UTSW 10 81181889 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGCACAACCGGCTGTACATG -3'
(R):5'- CATGCAGGGTCACATCATGAAC -3'

Sequencing Primer
(F):5'- CAACCGGCTGTACATGAAGGC -3'
(R):5'- GGTCACATCATGAACATCAAACCG -3'
Posted On2018-06-06