Incidental Mutation 'R6545:Cfap54'
ID521122
Institutional Source Beutler Lab
Gene Symbol Cfap54
Ensembl Gene ENSMUSG00000020014
Gene Namecilia and flagella associated protein 54
SynonymsLOC380653, Gm872, 4930485B16Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.208) question?
Stock #R6545 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location92775619-93081618 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 92836457 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 2917 (R2917H)
Ref Sequence ENSEMBL: ENSMUSP00000148636 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000168110] [ENSMUST00000212902]
Predicted Effect probably benign
Transcript: ENSMUST00000163209
Predicted Effect unknown
Transcript: ENSMUST00000168110
AA Change: R2852H
SMART Domains Protein: ENSMUSP00000129517
Gene: ENSMUSG00000020014
AA Change: R2852H

DomainStartEndE-ValueType
low complexity region 3 37 N/A INTRINSIC
low complexity region 39 48 N/A INTRINSIC
Pfam:DUF4486 104 642 1.1e-269 PFAM
low complexity region 842 851 N/A INTRINSIC
low complexity region 902 915 N/A INTRINSIC
Blast:FN3 916 1002 4e-48 BLAST
low complexity region 1409 1426 N/A INTRINSIC
low complexity region 1974 1984 N/A INTRINSIC
low complexity region 2354 2370 N/A INTRINSIC
low complexity region 2500 2513 N/A INTRINSIC
low complexity region 2605 2616 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000212902
AA Change: R2917H

PolyPhen 2 Score 0.306 (Sensitivity: 0.90; Specificity: 0.89)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.6%
Validation Efficiency 95% (42/44)
MGI Phenotype PHENOTYPE: Homozygous inactivation of this gene causes background-dependent lethality and hydroencephaly, male sterility associated with defects in spermiogenesis, and impaired mucociliary clearance. Airway epithelial cilia show structural defects and a decrease in ciliary beat frequency and cilia-driven flow. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ago1 C T 4: 126,454,352 A58T possibly damaging Het
Ago4 T A 4: 126,512,018 Q366L probably benign Het
Card10 C A 15: 78,776,810 G950V probably damaging Het
Ceacam1 A T 7: 25,473,854 V303D probably damaging Het
Cit A G 5: 115,846,434 S22G probably null Het
Cog4 A G 8: 110,880,945 E666G probably damaging Het
Crocc2 A G 1: 93,212,937 D1103G probably benign Het
Cttnbp2 A T 6: 18,405,279 probably null Het
Dctn3 T C 4: 41,723,084 E16G probably damaging Het
Dnah6 A G 6: 73,044,732 S3536P probably damaging Het
Eef2 T A 10: 81,181,114 I675N probably damaging Het
Gga3 A G 11: 115,587,169 F531S possibly damaging Het
Gm19410 A G 8: 35,790,498 R697G possibly damaging Het
Gm3173 T A 14: 4,514,810 M18K possibly damaging Het
Gm35339 C T 15: 76,363,378 R1585C probably damaging Het
Gm5800 A T 14: 51,711,962 S175R possibly damaging Het
Gria2 T C 3: 80,741,144 K95R probably damaging Het
Gstm6 A G 3: 107,942,365 I76T probably damaging Het
Harbi1 T G 2: 91,712,295 Y34D probably damaging Het
Hectd2 C A 19: 36,587,378 Q20K probably benign Het
Inpp5f C A 7: 128,694,556 A250D possibly damaging Het
Irf9 T C 14: 55,605,227 F59L probably damaging Het
Itgam T A 7: 128,107,872 M625K probably damaging Het
Kcnh5 C T 12: 75,007,658 R504Q probably damaging Het
Lama2 T C 10: 27,176,797 T1389A probably benign Het
Lin54 T A 5: 100,485,137 probably null Het
Mettl23 A G 11: 116,849,216 D171G possibly damaging Het
Mgll A G 6: 88,825,703 N296S probably benign Het
Mpv17 T A 5: 31,144,697 probably benign Het
Myof A T 19: 37,942,297 M1001K possibly damaging Het
Myom1 A T 17: 71,082,305 Q850L probably benign Het
Olfr509 A T 7: 108,646,455 N40K probably damaging Het
Pias2 A G 18: 77,130,085 I328V possibly damaging Het
Polh G A 17: 46,182,759 P311S possibly damaging Het
Prss34 A T 17: 25,298,835 R61S probably benign Het
Rassf2 A T 2: 131,998,317 M280K probably damaging Het
Rpsa A G 9: 120,130,257 H47R probably benign Het
Rtp3 A G 9: 110,986,826 V219A possibly damaging Het
Smarcc2 T C 10: 128,484,128 I790T probably benign Het
Stag3 A G 5: 138,298,352 T491A possibly damaging Het
Svil C T 18: 5,108,621 H2007Y probably benign Het
Togaram1 T G 12: 64,978,207 C750G possibly damaging Het
Vmn2r13 A T 5: 109,156,940 probably null Het
Vmn2r4 A T 3: 64,406,356 D401E possibly damaging Het
Wsb1 A T 11: 79,251,055 D45E probably damaging Het
Zfp808 T A 13: 62,171,895 Y313N probably benign Het
Other mutations in Cfap54
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01329:Cfap54 APN 10 93081523 missense unknown
IGL02034:Cfap54 APN 10 93061485 missense probably damaging 0.99
IGL02082:Cfap54 APN 10 93081458 missense unknown
IGL02434:Cfap54 APN 10 93066754 missense probably benign 0.20
R0011:Cfap54 UTSW 10 93065225 missense probably damaging 0.97
R0011:Cfap54 UTSW 10 93065225 missense probably damaging 0.97
R0032:Cfap54 UTSW 10 92932697 missense probably benign 0.04
R0032:Cfap54 UTSW 10 92932697 missense probably benign 0.04
R0040:Cfap54 UTSW 10 92977039 missense probably benign 0.33
R0044:Cfap54 UTSW 10 93035433 missense probably null 0.28
R0086:Cfap54 UTSW 10 93028594 missense possibly damaging 0.86
R0104:Cfap54 UTSW 10 93028652 missense probably damaging 1.00
R0194:Cfap54 UTSW 10 93034662 unclassified probably benign
R0234:Cfap54 UTSW 10 92899160 nonsense probably null
R0308:Cfap54 UTSW 10 92885364 missense unknown
R0332:Cfap54 UTSW 10 93035457 missense probably damaging 1.00
R0409:Cfap54 UTSW 10 92776213 missense probably benign 0.00
R0433:Cfap54 UTSW 10 92979080 splice site probably benign
R0436:Cfap54 UTSW 10 93038975 missense possibly damaging 0.95
R0463:Cfap54 UTSW 10 92874943 critical splice donor site probably null
R0523:Cfap54 UTSW 10 92908883 utr 3 prime probably benign
R0551:Cfap54 UTSW 10 93025122 missense probably benign 0.35
R0595:Cfap54 UTSW 10 92884736 missense unknown
R0617:Cfap54 UTSW 10 92829650 splice site probably benign
R0632:Cfap54 UTSW 10 92885096 missense unknown
R0730:Cfap54 UTSW 10 93034737 missense probably benign 0.05
R0786:Cfap54 UTSW 10 92967535 missense possibly damaging 0.72
R0883:Cfap54 UTSW 10 92870669 missense unknown
R1004:Cfap54 UTSW 10 93066696 splice site probably benign
R1033:Cfap54 UTSW 10 92839449 missense probably benign 0.07
R1168:Cfap54 UTSW 10 92937920 missense probably damaging 0.99
R1186:Cfap54 UTSW 10 92875994 missense unknown
R1429:Cfap54 UTSW 10 92821038 missense probably benign 0.01
R1443:Cfap54 UTSW 10 92932721 missense probably damaging 1.00
R1467:Cfap54 UTSW 10 92969763 missense probably benign 0.01
R1557:Cfap54 UTSW 10 92984227 missense possibly damaging 0.68
R1687:Cfap54 UTSW 10 92932640 missense probably damaging 1.00
R1690:Cfap54 UTSW 10 93035442 missense possibly damaging 0.95
R1711:Cfap54 UTSW 10 93011020 missense possibly damaging 0.86
R1756:Cfap54 UTSW 10 93048061 missense probably damaging 1.00
R1769:Cfap54 UTSW 10 92904263 critical splice donor site probably null
R1835:Cfap54 UTSW 10 92962375 missense probably benign 0.35
R1889:Cfap54 UTSW 10 93034710 missense possibly damaging 0.94
R1915:Cfap54 UTSW 10 92884702 missense unknown
R1958:Cfap54 UTSW 10 92997342 missense probably benign 0.18
R2005:Cfap54 UTSW 10 92884768 missense unknown
R2018:Cfap54 UTSW 10 93016604 missense probably benign 0.00
R2045:Cfap54 UTSW 10 93038809 splice site probably null
R2059:Cfap54 UTSW 10 92942979 unclassified probably benign
R2100:Cfap54 UTSW 10 93001937 missense possibly damaging 0.84
R2110:Cfap54 UTSW 10 92886367 missense unknown
R2392:Cfap54 UTSW 10 93025011 critical splice donor site probably null
R2508:Cfap54 UTSW 10 92997374 missense possibly damaging 0.72
R2852:Cfap54 UTSW 10 92940155 missense probably damaging 1.00
R2857:Cfap54 UTSW 10 93045282 missense probably damaging 0.99
R2871:Cfap54 UTSW 10 92921419 missense possibly damaging 0.86
R2871:Cfap54 UTSW 10 92921419 missense possibly damaging 0.86
R3107:Cfap54 UTSW 10 92994683 missense probably benign 0.04
R3108:Cfap54 UTSW 10 92994683 missense probably benign 0.04
R3157:Cfap54 UTSW 10 92999056 missense probably benign 0.03
R3158:Cfap54 UTSW 10 92999056 missense probably benign 0.03
R3159:Cfap54 UTSW 10 92999056 missense probably benign 0.03
R3161:Cfap54 UTSW 10 93045278 missense probably damaging 1.00
R3162:Cfap54 UTSW 10 93045278 missense probably damaging 1.00
R3162:Cfap54 UTSW 10 93045278 missense probably damaging 1.00
R3508:Cfap54 UTSW 10 92885424 missense unknown
R3730:Cfap54 UTSW 10 93011473 nonsense probably null
R3770:Cfap54 UTSW 10 92878536 missense unknown
R3776:Cfap54 UTSW 10 93045100 missense probably damaging 1.00
R3778:Cfap54 UTSW 10 92904344 utr 3 prime probably benign
R3795:Cfap54 UTSW 10 92942873 unclassified probably benign
R3834:Cfap54 UTSW 10 92801123 splice site probably benign
R3891:Cfap54 UTSW 10 93038846 missense possibly damaging 0.87
R3932:Cfap54 UTSW 10 92829757 missense probably benign 0.03
R3973:Cfap54 UTSW 10 92839471 missense possibly damaging 0.95
R3974:Cfap54 UTSW 10 92839471 missense possibly damaging 0.95
R3976:Cfap54 UTSW 10 92839471 missense possibly damaging 0.95
R3978:Cfap54 UTSW 10 92962412 missense probably benign 0.01
R4190:Cfap54 UTSW 10 92885023 missense unknown
R4389:Cfap54 UTSW 10 92967500 missense probably benign 0.37
R4542:Cfap54 UTSW 10 93025129 missense probably benign 0.12
R4564:Cfap54 UTSW 10 92839540 unclassified probably benign
R4576:Cfap54 UTSW 10 93043228 critical splice donor site probably null
R4620:Cfap54 UTSW 10 92969757 missense probably benign 0.01
R4714:Cfap54 UTSW 10 92815918 missense probably benign 0.01
R4762:Cfap54 UTSW 10 93061453 splice site probably null
R4776:Cfap54 UTSW 10 92972694 missense possibly damaging 0.96
R4819:Cfap54 UTSW 10 92836477 nonsense probably null
R4827:Cfap54 UTSW 10 92902075 utr 3 prime probably benign
R4832:Cfap54 UTSW 10 92967528 missense probably benign 0.01
R4965:Cfap54 UTSW 10 93066799 missense probably benign 0.23
R5001:Cfap54 UTSW 10 92964534 missense probably benign 0.01
R5060:Cfap54 UTSW 10 93039151 missense probably damaging 1.00
R5067:Cfap54 UTSW 10 93066766 missense probably benign 0.17
R5069:Cfap54 UTSW 10 92937774 missense probably benign
R5094:Cfap54 UTSW 10 92898999 utr 3 prime probably benign
R5109:Cfap54 UTSW 10 92937891 missense probably benign 0.03
R5127:Cfap54 UTSW 10 92886387 splice site probably null
R5143:Cfap54 UTSW 10 93029158 missense possibly damaging 0.73
R5147:Cfap54 UTSW 10 92937838 missense probably benign 0.00
R5158:Cfap54 UTSW 10 93065197 missense probably damaging 1.00
R5256:Cfap54 UTSW 10 92935091 nonsense probably null
R5256:Cfap54 UTSW 10 93045023 splice site probably null
R5266:Cfap54 UTSW 10 92815902 missense probably benign 0.16
R5304:Cfap54 UTSW 10 92821106 missense probably damaging 0.97
R5369:Cfap54 UTSW 10 93061257 intron probably benign
R5406:Cfap54 UTSW 10 93001858 missense probably benign 0.33
R5471:Cfap54 UTSW 10 93028660 missense probably damaging 1.00
R5485:Cfap54 UTSW 10 93029117 missense probably damaging 1.00
R5540:Cfap54 UTSW 10 92972608 missense possibly damaging 0.85
R5586:Cfap54 UTSW 10 92972611 nonsense probably null
R5614:Cfap54 UTSW 10 93045049 missense probably damaging 1.00
R5634:Cfap54 UTSW 10 92904263 critical splice donor site probably benign
R5680:Cfap54 UTSW 10 92979017 nonsense probably null
R5797:Cfap54 UTSW 10 92967576 missense probably benign 0.11
R5859:Cfap54 UTSW 10 93016524 nonsense probably null
R5878:Cfap54 UTSW 10 92964561 missense probably benign 0.01
R5910:Cfap54 UTSW 10 93065181 missense probably damaging 0.99
R5936:Cfap54 UTSW 10 92962412 missense probably benign 0.01
R5994:Cfap54 UTSW 10 93039081 missense probably damaging 0.99
R6080:Cfap54 UTSW 10 93045335 missense possibly damaging 0.64
R6268:Cfap54 UTSW 10 93038909 missense probably damaging 1.00
R6296:Cfap54 UTSW 10 93066846 missense probably damaging 1.00
R6409:Cfap54 UTSW 10 92967492 missense probably benign 0.04
R6570:Cfap54 UTSW 10 92815958 missense unknown
R6597:Cfap54 UTSW 10 92999040 missense possibly damaging 0.85
R6702:Cfap54 UTSW 10 92868734 missense unknown
R6703:Cfap54 UTSW 10 92868734 missense unknown
R6720:Cfap54 UTSW 10 92821119 missense probably benign 0.07
R6841:Cfap54 UTSW 10 92875015 missense unknown
R6910:Cfap54 UTSW 10 92836512 missense probably benign 0.29
R6953:Cfap54 UTSW 10 92994678 missense probably benign 0.19
X0022:Cfap54 UTSW 10 92878603 missense unknown
X0022:Cfap54 UTSW 10 92932614 missense probably damaging 1.00
X0027:Cfap54 UTSW 10 92878538 missense unknown
X0027:Cfap54 UTSW 10 93001888 missense possibly damaging 0.86
Predicted Primers PCR Primer
(F):5'- GAAATCTCTGAGCCACTTGGAG -3'
(R):5'- TGTCACAGCAGGCAGTAAATG -3'

Sequencing Primer
(F):5'- GGCATGCTCGTTCCTGCAATAG -3'
(R):5'- TGAATACCAAGACTGAGACCATGCTG -3'
Posted On2018-06-06