Incidental Mutation 'R6545:Mettl23'
ID521130
Institutional Source Beutler Lab
Gene Symbol Mettl23
Ensembl Gene ENSMUSG00000090266
Gene Namemethyltransferase like 23
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.420) question?
Stock #R6545 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location116843278-116854263 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 116849216 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 171 (D171G)
Ref Sequence ENSEMBL: ENSMUSP00000101978 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021173] [ENSMUST00000092404] [ENSMUST00000106363] [ENSMUST00000106365] [ENSMUST00000106370] [ENSMUST00000136012] [ENSMUST00000136914] [ENSMUST00000139954] [ENSMUST00000143184] [ENSMUST00000153084] [ENSMUST00000190993]
Predicted Effect probably benign
Transcript: ENSMUST00000021173
SMART Domains Protein: ENSMUSP00000021173
Gene: ENSMUSG00000020818

DomainStartEndE-ValueType
Pfam:UNC-93 14 166 6.5e-56 PFAM
transmembrane domain 173 190 N/A INTRINSIC
transmembrane domain 239 261 N/A INTRINSIC
transmembrane domain 276 298 N/A INTRINSIC
transmembrane domain 305 327 N/A INTRINSIC
transmembrane domain 410 432 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000092404
SMART Domains Protein: ENSMUSP00000090059
Gene: ENSMUSG00000034120

DomainStartEndE-ValueType
RRM 15 88 1.79e-25 SMART
low complexity region 101 213 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106363
SMART Domains Protein: ENSMUSP00000101971
Gene: ENSMUSG00000020818

DomainStartEndE-ValueType
Pfam:UNC-93 14 92 6e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106365
SMART Domains Protein: ENSMUSP00000101973
Gene: ENSMUSG00000020818

DomainStartEndE-ValueType
Pfam:UNC-93 14 91 7.9e-26 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000106370
AA Change: D171G

PolyPhen 2 Score 0.882 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000101978
Gene: ENSMUSG00000090266
AA Change: D171G

DomainStartEndE-ValueType
low complexity region 5 22 N/A INTRINSIC
Pfam:Methyltransf_16 48 203 9.9e-20 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125920
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126661
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128784
Predicted Effect probably benign
Transcript: ENSMUST00000132593
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135135
Predicted Effect probably benign
Transcript: ENSMUST00000136012
SMART Domains Protein: ENSMUSP00000118203
Gene: ENSMUSG00000020818

DomainStartEndE-ValueType
Pfam:UNC-93 14 91 7.9e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000136914
SMART Domains Protein: ENSMUSP00000120086
Gene: ENSMUSG00000034120

DomainStartEndE-ValueType
RRM 15 88 1.79e-25 SMART
low complexity region 101 213 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138484
Predicted Effect probably benign
Transcript: ENSMUST00000139954
SMART Domains Protein: ENSMUSP00000118112
Gene: ENSMUSG00000020818

DomainStartEndE-ValueType
Pfam:UNC-93 14 91 7.9e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000140869
Predicted Effect probably benign
Transcript: ENSMUST00000143184
SMART Domains Protein: ENSMUSP00000119131
Gene: ENSMUSG00000090266

DomainStartEndE-ValueType
Pfam:Methyltransf_16 1 82 1e-9 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151944
Predicted Effect probably benign
Transcript: ENSMUST00000153084
SMART Domains Protein: ENSMUSP00000123368
Gene: ENSMUSG00000020818

DomainStartEndE-ValueType
Pfam:UNC-93 14 115 7.4e-33 PFAM
transmembrane domain 119 138 N/A INTRINSIC
transmembrane domain 187 209 N/A INTRINSIC
transmembrane domain 224 246 N/A INTRINSIC
transmembrane domain 253 275 N/A INTRINSIC
transmembrane domain 358 380 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175930
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176765
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176799
Predicted Effect probably benign
Transcript: ENSMUST00000176834
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177429
Predicted Effect probably benign
Transcript: ENSMUST00000190993
SMART Domains Protein: ENSMUSP00000140016
Gene: ENSMUSG00000034120

DomainStartEndE-ValueType
RRM 15 88 1.79e-25 SMART
low complexity region 101 213 N/A INTRINSIC
Meta Mutation Damage Score 0.198 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.6%
Validation Efficiency 95% (42/44)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene functions as a transcription factor regulator in the transcriptional pathway for human cognition. It is a partner of the alpha subunit of the GA-binding protein transcription factor. Mutations in this gene cause mild autosomal recessive intellectual disability. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2014]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ago1 C T 4: 126,454,352 A58T possibly damaging Het
Ago4 T A 4: 126,512,018 Q366L probably benign Het
Card10 C A 15: 78,776,810 G950V probably damaging Het
Ceacam1 A T 7: 25,473,854 V303D probably damaging Het
Cfap54 C T 10: 92,836,457 R2917H probably benign Het
Cit A G 5: 115,846,434 S22G probably null Het
Cog4 A G 8: 110,880,945 E666G probably damaging Het
Crocc2 A G 1: 93,212,937 D1103G probably benign Het
Cttnbp2 A T 6: 18,405,279 probably null Het
Dctn3 T C 4: 41,723,084 E16G probably damaging Het
Dnah6 A G 6: 73,044,732 S3536P probably damaging Het
Eef2 T A 10: 81,181,114 I675N probably damaging Het
Gga3 A G 11: 115,587,169 F531S possibly damaging Het
Gm19410 A G 8: 35,790,498 R697G possibly damaging Het
Gm3173 T A 14: 4,514,810 M18K possibly damaging Het
Gm35339 C T 15: 76,363,378 R1585C probably damaging Het
Gm5800 A T 14: 51,711,962 S175R possibly damaging Het
Gria2 T C 3: 80,741,144 K95R probably damaging Het
Gstm6 A G 3: 107,942,365 I76T probably damaging Het
Harbi1 T G 2: 91,712,295 Y34D probably damaging Het
Hectd2 C A 19: 36,587,378 Q20K probably benign Het
Inpp5f C A 7: 128,694,556 A250D possibly damaging Het
Irf9 T C 14: 55,605,227 F59L probably damaging Het
Itgam T A 7: 128,107,872 M625K probably damaging Het
Kcnh5 C T 12: 75,007,658 R504Q probably damaging Het
Lama2 T C 10: 27,176,797 T1389A probably benign Het
Lin54 T A 5: 100,485,137 probably null Het
Mgll A G 6: 88,825,703 N296S probably benign Het
Mpv17 T A 5: 31,144,697 probably benign Het
Myof A T 19: 37,942,297 M1001K possibly damaging Het
Myom1 A T 17: 71,082,305 Q850L probably benign Het
Olfr509 A T 7: 108,646,455 N40K probably damaging Het
Pias2 A G 18: 77,130,085 I328V possibly damaging Het
Polh G A 17: 46,182,759 P311S possibly damaging Het
Prss34 A T 17: 25,298,835 R61S probably benign Het
Rassf2 A T 2: 131,998,317 M280K probably damaging Het
Rpsa A G 9: 120,130,257 H47R probably benign Het
Rtp3 A G 9: 110,986,826 V219A possibly damaging Het
Smarcc2 T C 10: 128,484,128 I790T probably benign Het
Stag3 A G 5: 138,298,352 T491A possibly damaging Het
Svil C T 18: 5,108,621 H2007Y probably benign Het
Togaram1 T G 12: 64,978,207 C750G possibly damaging Het
Vmn2r13 A T 5: 109,156,940 probably null Het
Vmn2r4 A T 3: 64,406,356 D401E possibly damaging Het
Wsb1 A T 11: 79,251,055 D45E probably damaging Het
Zfp808 T A 13: 62,171,895 Y313N probably benign Het
Other mutations in Mettl23
AlleleSourceChrCoordTypePredicted EffectPPH Score
stretch UTSW 11 116849039 nonsense probably null
R0437:Mettl23 UTSW 11 116849294 missense possibly damaging 0.90
R4243:Mettl23 UTSW 11 116848300 missense possibly damaging 0.87
R5564:Mettl23 UTSW 11 116849039 nonsense probably null
R5573:Mettl23 UTSW 11 116843611 unclassified probably benign
R5593:Mettl23 UTSW 11 116843767 missense probably damaging 0.98
R6077:Mettl23 UTSW 11 116848902 missense possibly damaging 0.66
R7315:Mettl23 UTSW 11 116849102 missense probably benign 0.41
X0060:Mettl23 UTSW 11 116843640 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- GTTGCCAGATGAATAACCTGCC -3'
(R):5'- CCTTCAAGTGACCAGTCAGCAC -3'

Sequencing Primer
(F):5'- CTGCCACAGGTCGAAGTTGTAG -3'
(R):5'- ATACTCACCTTCGGACCTG -3'
Posted On2018-06-06