Incidental Mutation 'R6545:Kcnh5'
ID521134
Institutional Source Beutler Lab
Gene Symbol Kcnh5
Ensembl Gene ENSMUSG00000034402
Gene Namepotassium voltage-gated channel, subfamily H (eag-related), member 5
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6545 (G1)
Quality Score225.009
Status Validated
Chromosome12
Chromosomal Location74897220-75177332 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 75007658 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glutamine at position 504 (R504Q)
Ref Sequence ENSEMBL: ENSMUSP00000046864 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042299]
Predicted Effect probably damaging
Transcript: ENSMUST00000042299
AA Change: R504Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000046864
Gene: ENSMUSG00000034402
AA Change: R504Q

DomainStartEndE-ValueType
PAS 14 86 8.97e0 SMART
PAC 92 134 6.64e-7 SMART
Pfam:Ion_trans 214 479 1.2e-37 PFAM
Pfam:Ion_trans_2 390 473 5e-14 PFAM
cNMP 550 668 2.48e-15 SMART
low complexity region 710 717 N/A INTRINSIC
coiled coil region 907 944 N/A INTRINSIC
low complexity region 953 968 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.6%
Validation Efficiency 95% (42/44)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of voltage-gated potassium channels. Members of this family have diverse functions, including regulating neurotransmitter and hormone release, cardiac function, and cell volume. This protein is an outward-rectifying, noninactivating channel. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2013]
PHENOTYPE: Mice homozygous for a targeted gene disruption display thigmotaxis and abnormal startle reflex. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ago1 C T 4: 126,454,352 A58T possibly damaging Het
Ago4 T A 4: 126,512,018 Q366L probably benign Het
Card10 C A 15: 78,776,810 G950V probably damaging Het
Ceacam1 A T 7: 25,473,854 V303D probably damaging Het
Cfap54 C T 10: 92,836,457 R2917H probably benign Het
Cit A G 5: 115,846,434 S22G probably null Het
Cog4 A G 8: 110,880,945 E666G probably damaging Het
Crocc2 A G 1: 93,212,937 D1103G probably benign Het
Cttnbp2 A T 6: 18,405,279 probably null Het
Dctn3 T C 4: 41,723,084 E16G probably damaging Het
Dnah6 A G 6: 73,044,732 S3536P probably damaging Het
Eef2 T A 10: 81,181,114 I675N probably damaging Het
Gga3 A G 11: 115,587,169 F531S possibly damaging Het
Gm19410 A G 8: 35,790,498 R697G possibly damaging Het
Gm3173 T A 14: 4,514,810 M18K possibly damaging Het
Gm35339 C T 15: 76,363,378 R1585C probably damaging Het
Gm5800 A T 14: 51,711,962 S175R possibly damaging Het
Gria2 T C 3: 80,741,144 K95R probably damaging Het
Gstm6 A G 3: 107,942,365 I76T probably damaging Het
Harbi1 T G 2: 91,712,295 Y34D probably damaging Het
Hectd2 C A 19: 36,587,378 Q20K probably benign Het
Inpp5f C A 7: 128,694,556 A250D possibly damaging Het
Irf9 T C 14: 55,605,227 F59L probably damaging Het
Itgam T A 7: 128,107,872 M625K probably damaging Het
Lama2 T C 10: 27,176,797 T1389A probably benign Het
Lin54 T A 5: 100,485,137 probably null Het
Mettl23 A G 11: 116,849,216 D171G possibly damaging Het
Mgll A G 6: 88,825,703 N296S probably benign Het
Mpv17 T A 5: 31,144,697 probably benign Het
Myof A T 19: 37,942,297 M1001K possibly damaging Het
Myom1 A T 17: 71,082,305 Q850L probably benign Het
Olfr509 A T 7: 108,646,455 N40K probably damaging Het
Pias2 A G 18: 77,130,085 I328V possibly damaging Het
Polh G A 17: 46,182,759 P311S possibly damaging Het
Prss34 A T 17: 25,298,835 R61S probably benign Het
Rassf2 A T 2: 131,998,317 M280K probably damaging Het
Rpsa A G 9: 120,130,257 H47R probably benign Het
Rtp3 A G 9: 110,986,826 V219A possibly damaging Het
Smarcc2 T C 10: 128,484,128 I790T probably benign Het
Stag3 A G 5: 138,298,352 T491A possibly damaging Het
Svil C T 18: 5,108,621 H2007Y probably benign Het
Togaram1 T G 12: 64,978,207 C750G possibly damaging Het
Vmn2r13 A T 5: 109,156,940 probably null Het
Vmn2r4 A T 3: 64,406,356 D401E possibly damaging Het
Wsb1 A T 11: 79,251,055 D45E probably damaging Het
Zfp808 T A 13: 62,171,895 Y313N probably benign Het
Other mutations in Kcnh5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00470:Kcnh5 APN 12 74897796 missense probably benign 0.00
IGL00675:Kcnh5 APN 12 75114189 critical splice donor site probably null
IGL00688:Kcnh5 APN 12 74898397 missense probably benign 0.01
IGL00721:Kcnh5 APN 12 75007676 missense probably benign 0.32
IGL00793:Kcnh5 APN 12 75114346 missense probably damaging 0.99
IGL00802:Kcnh5 APN 12 75007625 missense possibly damaging 0.62
IGL00920:Kcnh5 APN 12 74976493 missense probably damaging 1.00
IGL01595:Kcnh5 APN 12 74898327 missense probably benign 0.05
IGL01642:Kcnh5 APN 12 74965169 missense probably damaging 0.98
IGL01675:Kcnh5 APN 12 75114500 nonsense probably null
IGL01733:Kcnh5 APN 12 74965192 missense probably benign 0.02
IGL02006:Kcnh5 APN 12 74897548 missense probably damaging 0.99
IGL02075:Kcnh5 APN 12 75087605 missense probably benign 0.00
IGL02148:Kcnh5 APN 12 74897652 missense possibly damaging 0.86
IGL02155:Kcnh5 APN 12 75176538 utr 5 prime probably benign
IGL02304:Kcnh5 APN 12 74976697 missense probably benign 0.01
IGL02957:Kcnh5 APN 12 75007665 missense probably benign 0.01
R0305:Kcnh5 UTSW 12 75114397 missense probably benign 0.00
R0470:Kcnh5 UTSW 12 75114414 missense probably benign 0.22
R0553:Kcnh5 UTSW 12 75137673 missense probably benign 0.00
R0557:Kcnh5 UTSW 12 75114549 missense probably damaging 1.00
R0590:Kcnh5 UTSW 12 74965261 missense probably damaging 1.00
R0697:Kcnh5 UTSW 12 74976531 missense possibly damaging 0.80
R0699:Kcnh5 UTSW 12 74976531 missense possibly damaging 0.80
R1512:Kcnh5 UTSW 12 75119937 missense probably benign
R1728:Kcnh5 UTSW 12 75137691 missense probably benign 0.18
R1739:Kcnh5 UTSW 12 75114229 missense probably damaging 1.00
R1784:Kcnh5 UTSW 12 75137691 missense probably benign 0.18
R1956:Kcnh5 UTSW 12 74897584 missense probably benign 0.01
R1957:Kcnh5 UTSW 12 74897584 missense probably benign 0.01
R2155:Kcnh5 UTSW 12 74898456 critical splice acceptor site probably null
R2185:Kcnh5 UTSW 12 75130931 missense possibly damaging 0.95
R2237:Kcnh5 UTSW 12 75007719 missense probably benign 0.00
R2239:Kcnh5 UTSW 12 75007719 missense probably benign 0.00
R2483:Kcnh5 UTSW 12 75114471 missense probably damaging 1.00
R2655:Kcnh5 UTSW 12 75114540 missense probably damaging 1.00
R3767:Kcnh5 UTSW 12 75087576 missense possibly damaging 0.81
R3835:Kcnh5 UTSW 12 74898270 missense probably benign
R4681:Kcnh5 UTSW 12 75007623 missense probably benign 0.00
R4728:Kcnh5 UTSW 12 75007781 missense probably damaging 1.00
R4965:Kcnh5 UTSW 12 74965151 missense probably benign 0.11
R5127:Kcnh5 UTSW 12 74898084 missense probably benign 0.17
R5267:Kcnh5 UTSW 12 75087416 missense probably damaging 0.98
R5535:Kcnh5 UTSW 12 75130907 missense possibly damaging 0.76
R5590:Kcnh5 UTSW 12 74976689 missense probably benign 0.05
R5684:Kcnh5 UTSW 12 75137649 missense probably damaging 1.00
R5747:Kcnh5 UTSW 12 74898420 missense probably benign 0.04
R6123:Kcnh5 UTSW 12 75087591 missense probably benign 0.01
R6662:Kcnh5 UTSW 12 75007611 missense probably damaging 1.00
R7117:Kcnh5 UTSW 12 75114445 missense possibly damaging 0.87
R7161:Kcnh5 UTSW 12 74897709 missense probably benign 0.10
Z1088:Kcnh5 UTSW 12 74897761 missense probably benign 0.00
Z1088:Kcnh5 UTSW 12 74965295 missense possibly damaging 0.78
Predicted Primers PCR Primer
(F):5'- TTTCTAAAGCAATTGCACAGGG -3'
(R):5'- GCAGTGTAGTCAGGACTTCC -3'

Sequencing Primer
(F):5'- GCACAGGGCAATTGTGAATG -3'
(R):5'- CCGTTACCATGAGATGCT -3'
Posted On2018-06-06