Incidental Mutation 'R6545:Gm3173'
ID521138
Institutional Source Beutler Lab
Gene Symbol Gm3173
Ensembl Gene ENSMUSG00000079386
Gene Namepredicted gene 3173
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.311) question?
Stock #R6545 (G1)
Quality Score225.009
Status Not validated
Chromosome14
Chromosomal Location4430992-4519452 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 4514810 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 18 (M18K)
Ref Sequence ENSEMBL: ENSMUSP00000108396 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000112776] [ENSMUST00000164603] [ENSMUST00000166848]
Predicted Effect possibly damaging
Transcript: ENSMUST00000112776
AA Change: M18K

PolyPhen 2 Score 0.879 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000108396
Gene: ENSMUSG00000079386
AA Change: M18K

DomainStartEndE-ValueType
Pfam:Takusan 1 73 3e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000164603
SMART Domains Protein: ENSMUSP00000125850
Gene: ENSMUSG00000079386

DomainStartEndE-ValueType
Pfam:Takusan 1 74 2e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000166848
SMART Domains Protein: ENSMUSP00000127993
Gene: ENSMUSG00000079386

DomainStartEndE-ValueType
Pfam:Takusan 1 74 1.4e-27 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.6%
Validation Efficiency 95% (42/44)
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ago1 C T 4: 126,454,352 A58T possibly damaging Het
Ago4 T A 4: 126,512,018 Q366L probably benign Het
Card10 C A 15: 78,776,810 G950V probably damaging Het
Ceacam1 A T 7: 25,473,854 V303D probably damaging Het
Cfap54 C T 10: 92,836,457 R2917H probably benign Het
Cit A G 5: 115,846,434 S22G probably null Het
Cog4 A G 8: 110,880,945 E666G probably damaging Het
Crocc2 A G 1: 93,212,937 D1103G probably benign Het
Cttnbp2 A T 6: 18,405,279 probably null Het
Dctn3 T C 4: 41,723,084 E16G probably damaging Het
Dnah6 A G 6: 73,044,732 S3536P probably damaging Het
Eef2 T A 10: 81,181,114 I675N probably damaging Het
Gga3 A G 11: 115,587,169 F531S possibly damaging Het
Gm19410 A G 8: 35,790,498 R697G possibly damaging Het
Gm35339 C T 15: 76,363,378 R1585C probably damaging Het
Gm5800 A T 14: 51,711,962 S175R possibly damaging Het
Gria2 T C 3: 80,741,144 K95R probably damaging Het
Gstm6 A G 3: 107,942,365 I76T probably damaging Het
Harbi1 T G 2: 91,712,295 Y34D probably damaging Het
Hectd2 C A 19: 36,587,378 Q20K probably benign Het
Inpp5f C A 7: 128,694,556 A250D possibly damaging Het
Irf9 T C 14: 55,605,227 F59L probably damaging Het
Itgam T A 7: 128,107,872 M625K probably damaging Het
Kcnh5 C T 12: 75,007,658 R504Q probably damaging Het
Lama2 T C 10: 27,176,797 T1389A probably benign Het
Lin54 T A 5: 100,485,137 probably null Het
Mettl23 A G 11: 116,849,216 D171G possibly damaging Het
Mgll A G 6: 88,825,703 N296S probably benign Het
Mpv17 T A 5: 31,144,697 probably benign Het
Myof A T 19: 37,942,297 M1001K possibly damaging Het
Myom1 A T 17: 71,082,305 Q850L probably benign Het
Olfr509 A T 7: 108,646,455 N40K probably damaging Het
Pias2 A G 18: 77,130,085 I328V possibly damaging Het
Polh G A 17: 46,182,759 P311S possibly damaging Het
Prss34 A T 17: 25,298,835 R61S probably benign Het
Rassf2 A T 2: 131,998,317 M280K probably damaging Het
Rpsa A G 9: 120,130,257 H47R probably benign Het
Rtp3 A G 9: 110,986,826 V219A possibly damaging Het
Smarcc2 T C 10: 128,484,128 I790T probably benign Het
Stag3 A G 5: 138,298,352 T491A possibly damaging Het
Svil C T 18: 5,108,621 H2007Y probably benign Het
Togaram1 T G 12: 64,978,207 C750G possibly damaging Het
Vmn2r13 A T 5: 109,156,940 probably null Het
Vmn2r4 A T 3: 64,406,356 D401E possibly damaging Het
Wsb1 A T 11: 79,251,055 D45E probably damaging Het
Zfp808 T A 13: 62,171,895 Y313N probably benign Het
Other mutations in Gm3173
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01062:Gm3173 APN 14 4514887 critical splice donor site probably null
R4334:Gm3173 UTSW 14 4514779 missense possibly damaging 0.60
R6021:Gm3173 UTSW 14 4514873 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTGGAAGATAGCTTTTCTGCTC -3'
(R):5'- TTAAACACCTGTCAGGGCTAC -3'

Sequencing Primer
(F):5'- AAGATAGCTTTTCTGCTCTTTTAGG -3'
(R):5'- CACCTGTCAGGGCTACATAATTG -3'
Posted On2018-06-06