Incidental Mutation 'R6545:Gm35339'
ID521144
Institutional Source Beutler Lab
Gene Symbol Gm35339
Ensembl Gene ENSMUSG00000109179
Gene Namepredicted gene, 35339
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.236) question?
Stock #R6545 (G1)
Quality Score137.008
Status Validated
Chromosome15
Chromosomal Location76354432-76365201 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 76363378 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Cysteine at position 1585 (R1585C)
Ref Sequence ENSEMBL: ENSMUSP00000146420 (fasta)
Predicted Effect probably damaging
Transcript: ENSMUST00000208833
AA Change: R1585C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.064 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.6%
Validation Efficiency 95% (42/44)
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ago1 C T 4: 126,454,352 A58T possibly damaging Het
Ago4 T A 4: 126,512,018 Q366L probably benign Het
Card10 C A 15: 78,776,810 G950V probably damaging Het
Ceacam1 A T 7: 25,473,854 V303D probably damaging Het
Cfap54 C T 10: 92,836,457 R2917H probably benign Het
Cit A G 5: 115,846,434 S22G probably null Het
Cog4 A G 8: 110,880,945 E666G probably damaging Het
Crocc2 A G 1: 93,212,937 D1103G probably benign Het
Cttnbp2 A T 6: 18,405,279 probably null Het
Dctn3 T C 4: 41,723,084 E16G probably damaging Het
Dnah6 A G 6: 73,044,732 S3536P probably damaging Het
Eef2 T A 10: 81,181,114 I675N probably damaging Het
Gga3 A G 11: 115,587,169 F531S possibly damaging Het
Gm19410 A G 8: 35,790,498 R697G possibly damaging Het
Gm3173 T A 14: 4,514,810 M18K possibly damaging Het
Gm5800 A T 14: 51,711,962 S175R possibly damaging Het
Gria2 T C 3: 80,741,144 K95R probably damaging Het
Gstm6 A G 3: 107,942,365 I76T probably damaging Het
Harbi1 T G 2: 91,712,295 Y34D probably damaging Het
Hectd2 C A 19: 36,587,378 Q20K probably benign Het
Inpp5f C A 7: 128,694,556 A250D possibly damaging Het
Irf9 T C 14: 55,605,227 F59L probably damaging Het
Itgam T A 7: 128,107,872 M625K probably damaging Het
Kcnh5 C T 12: 75,007,658 R504Q probably damaging Het
Lama2 T C 10: 27,176,797 T1389A probably benign Het
Lin54 T A 5: 100,485,137 probably null Het
Mettl23 A G 11: 116,849,216 D171G possibly damaging Het
Mgll A G 6: 88,825,703 N296S probably benign Het
Mpv17 T A 5: 31,144,697 probably benign Het
Myof A T 19: 37,942,297 M1001K possibly damaging Het
Myom1 A T 17: 71,082,305 Q850L probably benign Het
Olfr509 A T 7: 108,646,455 N40K probably damaging Het
Pias2 A G 18: 77,130,085 I328V possibly damaging Het
Polh G A 17: 46,182,759 P311S possibly damaging Het
Prss34 A T 17: 25,298,835 R61S probably benign Het
Rassf2 A T 2: 131,998,317 M280K probably damaging Het
Rpsa A G 9: 120,130,257 H47R probably benign Het
Rtp3 A G 9: 110,986,826 V219A possibly damaging Het
Smarcc2 T C 10: 128,484,128 I790T probably benign Het
Stag3 A G 5: 138,298,352 T491A possibly damaging Het
Svil C T 18: 5,108,621 H2007Y probably benign Het
Togaram1 T G 12: 64,978,207 C750G possibly damaging Het
Vmn2r13 A T 5: 109,156,940 probably null Het
Vmn2r4 A T 3: 64,406,356 D401E possibly damaging Het
Wsb1 A T 11: 79,251,055 D45E probably damaging Het
Zfp808 T A 13: 62,171,895 Y313N probably benign Het
Other mutations in Gm35339
AlleleSourceChrCoordTypePredicted EffectPPH Score
R6006:Gm35339 UTSW 15 76357172 missense probably damaging 1.00
R6258:Gm35339 UTSW 15 76355695 nonsense probably null
R6464:Gm35339 UTSW 15 76362777 missense probably benign 0.01
R6544:Gm35339 UTSW 15 76358278 missense probably benign 0.00
R6554:Gm35339 UTSW 15 76354978 missense possibly damaging 0.64
R6803:Gm35339 UTSW 15 76356576 missense probably damaging 1.00
R6850:Gm35339 UTSW 15 76357796 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACAGCAGCAGAGATCATCGATG -3'
(R):5'- GCTCTGCATCTTGTGACCTG -3'

Sequencing Primer
(F):5'- GAAGAGGAGCATTTACCTGTCTCAC -3'
(R):5'- TGACCTGGATGTGGGAAGCC -3'
Posted On2018-06-06