Incidental Mutation 'R6545:Polh'
ID521149
Institutional Source Beutler Lab
Gene Symbol Polh
Ensembl Gene ENSMUSG00000023953
Gene Namepolymerase (DNA directed), eta (RAD 30 related)
SynonymsRAD30A
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.340) question?
Stock #R6545 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location46172004-46202625 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 46182759 bp
ZygosityHeterozygous
Amino Acid Change Proline to Serine at position 311 (P311S)
Ref Sequence ENSEMBL: ENSMUSP00000024749 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024749]
Predicted Effect possibly damaging
Transcript: ENSMUST00000024749
AA Change: P311S

PolyPhen 2 Score 0.740 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000024749
Gene: ENSMUSG00000023953
AA Change: P311S

DomainStartEndE-ValueType
Pfam:IMS 12 227 9.7e-53 PFAM
Pfam:IMS_C 308 435 5.8e-15 PFAM
low complexity region 515 529 N/A INTRINSIC
low complexity region 540 561 N/A INTRINSIC
PDB:2I5O|A 606 643 7e-15 PDB
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.6%
Validation Efficiency 95% (42/44)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Y family of specialized DNA polymerases. It copies undamaged DNA with a lower fidelity than other DNA-directed polymerases. However, it accurately replicates UV-damaged DNA; when thymine dimers are present, this polymerase inserts the complementary nucleotides in the newly synthesized DNA, thereby bypassing the lesion and suppressing the mutagenic effect of UV-induced DNA damage. This polymerase is thought to be involved in hypermutation during immunoglobulin class switch recombination. Mutations in this gene result in XPV, a variant type of xeroderma pigmentosum. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2014]
PHENOTYPE: Homozygous inactivation of this gene causes increased susceptibility to UV-induced skin tumors and results in reduced immunoglobulin gene mutations at A-T base pairs with a G-C biased mutation pattern. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ago1 C T 4: 126,454,352 A58T possibly damaging Het
Ago4 T A 4: 126,512,018 Q366L probably benign Het
Card10 C A 15: 78,776,810 G950V probably damaging Het
Ceacam1 A T 7: 25,473,854 V303D probably damaging Het
Cfap54 C T 10: 92,836,457 R2917H probably benign Het
Cit A G 5: 115,846,434 S22G probably null Het
Cog4 A G 8: 110,880,945 E666G probably damaging Het
Crocc2 A G 1: 93,212,937 D1103G probably benign Het
Cttnbp2 A T 6: 18,405,279 probably null Het
Dctn3 T C 4: 41,723,084 E16G probably damaging Het
Dnah6 A G 6: 73,044,732 S3536P probably damaging Het
Eef2 T A 10: 81,181,114 I675N probably damaging Het
Gga3 A G 11: 115,587,169 F531S possibly damaging Het
Gm19410 A G 8: 35,790,498 R697G possibly damaging Het
Gm3173 T A 14: 4,514,810 M18K possibly damaging Het
Gm35339 C T 15: 76,363,378 R1585C probably damaging Het
Gm5800 A T 14: 51,711,962 S175R possibly damaging Het
Gria2 T C 3: 80,741,144 K95R probably damaging Het
Gstm6 A G 3: 107,942,365 I76T probably damaging Het
Harbi1 T G 2: 91,712,295 Y34D probably damaging Het
Hectd2 C A 19: 36,587,378 Q20K probably benign Het
Inpp5f C A 7: 128,694,556 A250D possibly damaging Het
Irf9 T C 14: 55,605,227 F59L probably damaging Het
Itgam T A 7: 128,107,872 M625K probably damaging Het
Kcnh5 C T 12: 75,007,658 R504Q probably damaging Het
Lama2 T C 10: 27,176,797 T1389A probably benign Het
Lin54 T A 5: 100,485,137 probably null Het
Mettl23 A G 11: 116,849,216 D171G possibly damaging Het
Mgll A G 6: 88,825,703 N296S probably benign Het
Mpv17 T A 5: 31,144,697 probably benign Het
Myof A T 19: 37,942,297 M1001K possibly damaging Het
Myom1 A T 17: 71,082,305 Q850L probably benign Het
Olfr509 A T 7: 108,646,455 N40K probably damaging Het
Pias2 A G 18: 77,130,085 I328V possibly damaging Het
Prss34 A T 17: 25,298,835 R61S probably benign Het
Rassf2 A T 2: 131,998,317 M280K probably damaging Het
Rpsa A G 9: 120,130,257 H47R probably benign Het
Rtp3 A G 9: 110,986,826 V219A possibly damaging Het
Smarcc2 T C 10: 128,484,128 I790T probably benign Het
Stag3 A G 5: 138,298,352 T491A possibly damaging Het
Svil C T 18: 5,108,621 H2007Y probably benign Het
Togaram1 T G 12: 64,978,207 C750G possibly damaging Het
Vmn2r13 A T 5: 109,156,940 probably null Het
Vmn2r4 A T 3: 64,406,356 D401E possibly damaging Het
Wsb1 A T 11: 79,251,055 D45E probably damaging Het
Zfp808 T A 13: 62,171,895 Y313N probably benign Het
Other mutations in Polh
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00484:Polh APN 17 46172243 unclassified probably benign
IGL00585:Polh APN 17 46172243 unclassified probably benign
IGL01812:Polh APN 17 46172911 missense probably benign 0.04
IGL01996:Polh APN 17 46173001 missense probably benign 0.00
IGL02578:Polh APN 17 46194292 nonsense probably null
IGL02829:Polh APN 17 46172902 missense possibly damaging 0.82
IGL03003:Polh APN 17 46194366 missense possibly damaging 0.57
R1435:Polh UTSW 17 46194255 missense probably damaging 1.00
R2091:Polh UTSW 17 46181454 splice site probably benign
R2129:Polh UTSW 17 46188088 nonsense probably null
R4226:Polh UTSW 17 46172594 missense probably benign
R4227:Polh UTSW 17 46172594 missense probably benign
R5483:Polh UTSW 17 46172745 missense probably benign 0.01
R5878:Polh UTSW 17 46194325 missense probably damaging 0.99
R6039:Polh UTSW 17 46188033 missense probably benign 0.00
R6039:Polh UTSW 17 46188033 missense probably benign 0.00
R6177:Polh UTSW 17 46184744 missense possibly damaging 0.94
R6345:Polh UTSW 17 46182738 missense probably benign 0.03
R6712:Polh UTSW 17 46190729 missense probably benign 0.12
R7054:Polh UTSW 17 46198716 missense probably benign 0.24
Predicted Primers PCR Primer
(F):5'- TGCAGCCAGTCCTATTTTACAC -3'
(R):5'- TCGAATCTATAGGCCTGGTAGG -3'

Sequencing Primer
(F):5'- AGTCTGATGACAGCTCCAGTGTAC -3'
(R):5'- ATCTATAGGCCTGGTAGGATCAC -3'
Posted On2018-06-06