Incidental Mutation 'R6545:Pias2'
ID521155
Institutional Source Beutler Lab
Gene Symbol Pias2
Ensembl Gene ENSMUSG00000025423
Gene Nameprotein inhibitor of activated STAT 2
SynonymsARIP3, Miz1, PIASxalpha, PIASxbeta, Dib, 6330408K17Rik, PIASxb
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6545 (G1)
Quality Score225.009
Status Validated
Chromosome18
Chromosomal Location77065208-77155708 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 77130085 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 328 (I328V)
Ref Sequence ENSEMBL: ENSMUSP00000131485 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000114776] [ENSMUST00000114777] [ENSMUST00000168882]
Predicted Effect probably benign
Transcript: ENSMUST00000114776
AA Change: I328V

PolyPhen 2 Score 0.058 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000110424
Gene: ENSMUSG00000025423
AA Change: I328V

DomainStartEndE-ValueType
SAP 4 38 2.01e-5 SMART
low complexity region 95 110 N/A INTRINSIC
Pfam:PINIT 134 290 7e-45 PFAM
Pfam:zf-MIZ 335 384 4.9e-24 PFAM
low complexity region 468 476 N/A INTRINSIC
low complexity region 502 515 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000114777
AA Change: I335V

PolyPhen 2 Score 0.128 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000110425
Gene: ENSMUSG00000025423
AA Change: I335V

DomainStartEndE-ValueType
SAP 11 45 2.01e-5 SMART
low complexity region 102 117 N/A INTRINSIC
low complexity region 135 144 N/A INTRINSIC
Pfam:PINIT 145 297 4.8e-38 PFAM
Pfam:zf-MIZ 342 391 1.7e-24 PFAM
low complexity region 475 483 N/A INTRINSIC
low complexity region 509 522 N/A INTRINSIC
low complexity region 571 610 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000168882
AA Change: I328V

PolyPhen 2 Score 0.607 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000131485
Gene: ENSMUSG00000025423
AA Change: I328V

DomainStartEndE-ValueType
SAP 4 38 2.01e-5 SMART
low complexity region 95 110 N/A INTRINSIC
Pfam:PINIT 134 290 2.3e-44 PFAM
Pfam:zf-MIZ 335 384 2.6e-23 PFAM
low complexity region 468 476 N/A INTRINSIC
low complexity region 502 515 N/A INTRINSIC
low complexity region 564 603 N/A INTRINSIC
Meta Mutation Damage Score 0.128 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.6%
Validation Efficiency 95% (42/44)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the protein inhibitor of activated STAT (PIAS) family. PIAS proteins function as SUMO E3 ligases and play important roles in many cellular processes by mediating the sumoylation of target proteins. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. Isoforms of the encoded protein enhance the sumoylation of specific target proteins including the p53 tumor suppressor protein, c-Jun, and the androgen receptor. A pseudogene of this gene is located on the short arm of chromosome 4. The symbol MIZ1 has also been associated with ZBTB17 which is a different gene located on chromosome 1. [provided by RefSeq, Aug 2011]
PHENOTYPE: An uncharacterized gene trap insertion does not result in an obvious phenotype although abnormalities are reported in the testes. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ago1 C T 4: 126,454,352 A58T possibly damaging Het
Ago4 T A 4: 126,512,018 Q366L probably benign Het
Card10 C A 15: 78,776,810 G950V probably damaging Het
Ceacam1 A T 7: 25,473,854 V303D probably damaging Het
Cfap54 C T 10: 92,836,457 R2917H probably benign Het
Cit A G 5: 115,846,434 S22G probably null Het
Cog4 A G 8: 110,880,945 E666G probably damaging Het
Crocc2 A G 1: 93,212,937 D1103G probably benign Het
Cttnbp2 A T 6: 18,405,279 probably null Het
Dctn3 T C 4: 41,723,084 E16G probably damaging Het
Dnah6 A G 6: 73,044,732 S3536P probably damaging Het
Eef2 T A 10: 81,181,114 I675N probably damaging Het
Gga3 A G 11: 115,587,169 F531S possibly damaging Het
Gm19410 A G 8: 35,790,498 R697G possibly damaging Het
Gm3173 T A 14: 4,514,810 M18K possibly damaging Het
Gm35339 C T 15: 76,363,378 R1585C probably damaging Het
Gm5800 A T 14: 51,711,962 S175R possibly damaging Het
Gria2 T C 3: 80,741,144 K95R probably damaging Het
Gstm6 A G 3: 107,942,365 I76T probably damaging Het
Harbi1 T G 2: 91,712,295 Y34D probably damaging Het
Hectd2 C A 19: 36,587,378 Q20K probably benign Het
Inpp5f C A 7: 128,694,556 A250D possibly damaging Het
Irf9 T C 14: 55,605,227 F59L probably damaging Het
Itgam T A 7: 128,107,872 M625K probably damaging Het
Kcnh5 C T 12: 75,007,658 R504Q probably damaging Het
Lama2 T C 10: 27,176,797 T1389A probably benign Het
Lin54 T A 5: 100,485,137 probably null Het
Mettl23 A G 11: 116,849,216 D171G possibly damaging Het
Mgll A G 6: 88,825,703 N296S probably benign Het
Mpv17 T A 5: 31,144,697 probably benign Het
Myof A T 19: 37,942,297 M1001K possibly damaging Het
Myom1 A T 17: 71,082,305 Q850L probably benign Het
Olfr509 A T 7: 108,646,455 N40K probably damaging Het
Polh G A 17: 46,182,759 P311S possibly damaging Het
Prss34 A T 17: 25,298,835 R61S probably benign Het
Rassf2 A T 2: 131,998,317 M280K probably damaging Het
Rpsa A G 9: 120,130,257 H47R probably benign Het
Rtp3 A G 9: 110,986,826 V219A possibly damaging Het
Smarcc2 T C 10: 128,484,128 I790T probably benign Het
Stag3 A G 5: 138,298,352 T491A possibly damaging Het
Svil C T 18: 5,108,621 H2007Y probably benign Het
Togaram1 T G 12: 64,978,207 C750G possibly damaging Het
Vmn2r13 A T 5: 109,156,940 probably null Het
Vmn2r4 A T 3: 64,406,356 D401E possibly damaging Het
Wsb1 A T 11: 79,251,055 D45E probably damaging Het
Zfp808 T A 13: 62,171,895 Y313N probably benign Het
Other mutations in Pias2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00401:Pias2 APN 18 77133211 missense probably damaging 1.00
IGL01105:Pias2 APN 18 77133156 missense probably damaging 1.00
IGL02379:Pias2 APN 18 77145148 splice site probably benign
IGL02932:Pias2 APN 18 77145103 missense probably damaging 1.00
IGL03181:Pias2 APN 18 77133242 missense possibly damaging 0.83
IGL03389:Pias2 APN 18 77097658 missense probably damaging 1.00
IGL03138:Pias2 UTSW 18 77150100 critical splice donor site probably null
R0492:Pias2 UTSW 18 77105885 missense probably damaging 1.00
R0577:Pias2 UTSW 18 77097281 missense probably damaging 1.00
R1660:Pias2 UTSW 18 77120129 missense probably damaging 1.00
R1866:Pias2 UTSW 18 77152716 missense probably benign 0.03
R1901:Pias2 UTSW 18 77097443 nonsense probably null
R1996:Pias2 UTSW 18 77129063 critical splice donor site probably null
R2107:Pias2 UTSW 18 77097471 missense probably benign 0.35
R4439:Pias2 UTSW 18 77097703 missense probably damaging 1.00
R4603:Pias2 UTSW 18 77130107 missense probably damaging 0.99
R4747:Pias2 UTSW 18 77152792 makesense probably null
R4816:Pias2 UTSW 18 77105891 critical splice donor site probably null
R5697:Pias2 UTSW 18 77133188 missense probably damaging 1.00
R6265:Pias2 UTSW 18 77097258 missense probably damaging 1.00
R6375:Pias2 UTSW 18 77152670 missense possibly damaging 0.96
R6713:Pias2 UTSW 18 77065720 utr 5 prime probably null
R7193:Pias2 UTSW 18 77120121 missense possibly damaging 0.76
R7232:Pias2 UTSW 18 77133235 missense probably benign 0.02
R7253:Pias2 UTSW 18 77120115 missense probably damaging 0.97
R7259:Pias2 UTSW 18 77152720 missense possibly damaging 0.73
X0009:Pias2 UTSW 18 77145097 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- AAATATGTGATGCAGAGTTTGTTTGT -3'
(R):5'- TTTGTACATTCATTCTTCAGAACCAT -3'

Sequencing Primer
(F):5'- ATGCAGAGTTTGTTTGTTGATAATTC -3'
(R):5'- GCTGGTCCACAAAGCATGTTC -3'
Posted On2018-06-06